Human cytomegalovirus IE1 protein activates AP-1 ... - Semantic Scholar
Journal of General Virology (1999), 80, 961–969. Printed in Great Britain ...................................................................................................................................................................................................................................................................................
Human cytomegalovirus IE1 protein activates AP-1 through a cellular protein kinase(s) Sujeong Kim,1 Seung Shin Yu,2 Im Soon Lee,2 Shigeo Ohno,3 Jeongbin Yim,1 Sunyoung Kim2 and Hyen Sam Kang1 1, 2
Department of Microbiology, College of Natural Sciences1 and Institute for Molecular Biology and Genetics2, Seoul National University, Seoul 151-742, Korea 3 Department of Molecular Biology, Yokohama City University School of Medicine, Yokohama 236, Japan
During human cytomegalovirus (HCMV) infection, a rapid increase in AP-1 activity is detected. In this study, activation of transcription from promoters containing AP-1-binding sites by the IE1 protein of HCMV was examined. In transient transfection assays with reporter plasmids, it was found that IE1 strongly induced AP-1-driven transcription. Cells stably expressing IE1 also showed higher levels of AP-1 activity than did control cells. IE1 expression did not raise levels of c-jun and c-fos RNA, as determined by quantitative RT–PCR. AP-1 induction by IE1 was blocked efficiently by protein kinase inhibitors in a cell type-dependent manner ; for example, by staurosporine in the human microglial cell line U373MG and by H7 in the human promonocytic cell line U937. IE1driven activation of AP-1 was increased dramatically by mitogen-activated protein kinase/ extracellular signal-regulated kinase kinase kinase 1 (MEKK1). The results of this study indicate that IE1 activates AP-1 at the post-transcriptional level and that MEKK1 may play an important role in this process.
Introduction Human cytomegalovirus (HCMV) is a member of the subfamily Betaherpesvirinae, and is endemic in the human population. HCMV genes are expressed in a temporally regulated manner upon infection of permissive cells, dividing the virus life-cycle into three stages : immediate-early (IE), early and late (Mocarski, 1996). The IE genes encode the first set of proteins expressed upon infection, some of which are involved in ‘ fine-tuning ’ of the virus life-cycle. IE1 originates from the major IE region under the control of the major IE promoter. At least five exons are spliced alternatively from the major IE region, producing IE1 and IE2 (Stinski et al., 1983). A single mRNA species of 1n95 kb is transcribed for the 72 kDa IE1 protein, while there are multiple mRNAs for IE2, resulting in proteins of 86, 55 and 40 kDa. Transcripts for the IE1 and IE2 proteins share the first three exons, but differ in the structure of the last exons. The IE1 protein activates transcription from both homologous and heterologous viral and cellular promoters (Davis et al., 1987 ; Author for correspondence : Sunyoung Kim. Fax j82 2 875 0907. e-mail sunyoung!plaza.snu.ac.kr
0001-5926 # 1999 SGM
Tevethia et al., 1987 ; Cherrington & Mocarski, 1989 ; Sambucetti et al., 1989 ; Hagemeier et al., 1992 ; Michelson et al., 1994 ; Hayhurst et al., 1995 ; Margolis et al., 1995 ; Yurochko et al., 1995). AP-1 is a transcription factor composed of members of the Jun and Fos families (Angel & Karin, 1991 ; Angel & Herrlich, 1994). These proteins associate to form a variety of homo- and heterodimers that bind to a common site. The fine tuning of AP-1 activity is important for flexible regulation of cell growth, differentiation and development in response to different stimuli. It has been reported previously that induction of c-fos and c-jun, the major subunits of AP-1, occurs after HCMV infection (Boldogh et al., 1990, 1991, 1993 ; Hagemeier et al., 1992). AP-1 was found to be modulated in two phases during HCMV infection. At very early times after infection, there was a rapid increase in c-fos and c-jun that was not affected by either inactivation of the virus or inhibition of protein synthesis (Boldogh et al., 1990, 1991). These data indicated that activation of AP-1 was independent of de novo expression of HCMV IE proteins and possibly involved the interaction of viral particles with the cell. The second phase of the increase in c-fos RNA was detected 12 h post-infection (Hagemeier et al., 1992) and the HCMV IE products, IE1 and JGB
S. Kim and others
IE2, were implicated (Hagemeier et al., 1992 ; Monick et al., 1992). IE2 was also shown to activate the HCMV early promoter via an AP-1-binding site (Scully et al., 1995). However, the precise mechanism of activation of AP-1 by IE proteins is not yet understood completely. In this report, we present data showing that IE1 can upregulate the activity of AP-1 efficiently. Mitogen-activated protein kinase\extracellular signal-regulated kinase kinase kinase 1 (MEKK1), one of the protein kinases regulating AP-1 activity, acted synergistically with IE1 in transactivating AP-1. These results suggest that IE1 activates AP-1 through a protein kinase(s) involved in the cellular signal transduction pathway.
Methods
Cell culture. The human microglial cell line U373MG was grown in DMEM (Gibco BRL) supplemented with 10 % foetal bovine serum (Gibco BRL), 100 U\ml penicillin and 100 µg\ml streptomycin under 5 % CO in # a humidified incubator at 37 mC. The human promonocytic cell line U937 was grown in RPMI 1640 medium (Sigma) supplemented with 10 % foetal bovine serum, 100 U\ml penicillin and 100 µg\ml streptomycin.
Plasmids. The IE1 expression plasmid pRSV-IE1 was described previously (Kim et al., 1996). Other IE1 expression plasmids, pEQ336 and pEQ273 (Biegalke & Geballe, 1991), were provided by A. Geballe (Dept of Laboratory Medicine, University of Washington, Seattle, USA) and pRL60, pRL61 and pRL74 (Lafemina et al., 1989) were provided by G. S. Hayward (Johns Hopkins School of Medicine, Baltimore, USA). ∆56 fos CAT was kindly provided by J. Pierce (Harvard Medical School, Cambridge, USA), AP-1 CAT (Robbins et al., 1990) by P. D. Robbins (University of Pittsburgh, USA), k37tk CAT and tk CAT 9 by A. Courey (Dept of Chemistry and Biochemistry, University of California, Los Angeles, USA) and PDGF-A CAT by K. Semba (Institute of Medical Science, University of Tokyo, Japan). For high-level expression of kinase genes in U373MG and U937 cells, pSRα-puro was constructed by replacing the CMV promoter (BglII\PstI) and the SV40 promoter and neomycin-resistance (Neor) gene (PvuII\SfuI) of pCI-neo (Promega) with the SRα promoter, the mouse mammary tumour virus long terminal repeat and a puromycin-resistance gene. Expression vectors for Ras, MEKK1, KMMEKK, JNK1 and MKK4 were constructed by inserting appropriate fragments into appropriate restriction sites of pSRα-puro : a 560 bp BamHI fragment from pCEV4 c-ki-Ras into the SmaI site for SRαc-ki-Ras-puro, a 2 kbp EcoRI fragment from SRD-MEKK into the EcoRI site for SRα-MEKK-puro, a 2 kbp EcoRI fragment from S KMMEKK P6 into the EcoRI site for SRα-KMMEKK-puro, a 1n2 kbp BglII fragment from SR His-JNK1 into the SmaI site for SRα-JNK1-puro and a 1n2 kbp BamHI\XbaI fragment from pcDNA3-FlagMKK4 into the EcoRI\XbaI sites for SRα-MKK4-puro. An expression vector for the catalytic domain of MEKK1, pSRα-MEKK∆N-puro, was constructed by inserting a 1 kbp NcoI\NotI fragment from SRα-MEKK-puro into the SmaI\NotI site of pSRα-puro. pCEV4 c-ki-Ras, SRD-MEKK, S KM MEKK P6 and SR HisJNK1 were described previously (Hirano et al., 1996) and pcDNA3FlagMKK4 (De! rijard et al., 1995) was a gift of R. Davis (University of Massachusetts Medical School, Worcester, USA).
Transfections and CAT assays. For transient expression assays, U373MG cells were transfected by the DEAE–dextran method, as described previously (Ikeuchi et al., 1990). U937 cells were transfected by the DEAE–dextran method as modified by Grosschedl & Baltimore (1985). Transfection efficiency was examined by co-transfection of 1 µg JGC
of a control plasmid that contained the β-galactosidase gene. CAT activity was determined according to a standard method (Gorman et al., 1982). The amount of acetylation was quantified by phosphorimager (Fuji).
Construction of cells stably expressing IE1. To construct a retroviral vector expressing IE1, a 2n9 kbp HindIII\ClaI fragment from pRSV-IE1 was subcloned into HindIII\ClaI-digested LNCX (Miller et al., 1993), resulting in LNC-gIE1. LNC-gIE1 was transfected into 293T cells, together with expression vectors for amphotropic Moloney-murine leukaemia virus env (pHIT456) and gag-pol (pHIT60), by the calciumphosphate method, as described elsewhere (Soneoka et al., 1995). The parental retroviral vector LNCX was used as a negative control. At 48 h post-transfection, virus supernatants were harvested and filtered through a 0n45 µm filter. U373MG and U937 cells were transduced by the retroviral vectors in the presence of 8 µg\ml polybrene, and G418 (1 mg\ml) was added 24 h after transduction. This medium was changed every 3 days and selection was continued for a further 4 weeks. G418resistant U373MG cells were subcloned by using a cloning cylinder. For U937 cells, resistant cells were subcloned by limiting dilution. The presence of IE1 was confirmed in both cells by Western blot analysis, immunoprecipitation and immunofluorescence with a monoclonal antibody that can detect IE1 (MAB810 ; Chemicon).
RNA preparation and quantitative RT–PCR. Total cellular RNA was isolated by using Trizol reagent (Gibco BRL) according to the manufacturer’s instructions. For a positive control, LNCX cells (U373MG and U937 cells) were treated with phorbol 12-myristate 13-acetate (PMA) (50 ng\ml) for 2 h. RNA (2 µg) was reverse-transcribed by using AMV reverse transcriptase (Promega) and 2 µg oligo(dT) primer (Pharmacia). The resulting cDNA was diluted to a final volume of 150 µl and 10 µl of the diluted cDNA was used in a PCR reaction. In addition to the cDNA, the reaction mixture included 2n5 units ExTaq polymerase (Takara), 200 nM each primer and 0n25 mM each dNTP in 50 µl. The reaction was incubated for 30 cycles of 94 mC for 1 min, 65 mC for 1 min and 72 mC for 90 s. The levels of c-fos and c-jun RNA were quantified by competitive PCR with their respective competitors. The competitive template for c-fos was generated by insertion of a 296 bp heterologous DNA fragment (isolated from the Neor gene) into the NcoI site of the human c-fos gene. The primers used to amplify the c-fos fragment were 5h AGCCCGCTCCGTGCCAGACA 3h and 5h GTGGGCAGCTGCACAGCTGG 3h. A 210 bp fragment from c-fos and a 506 bp fragment from the competitive template were produced with these primers. The competitive template for c-jun was generated by insertion of a 246 bp heterologous DNA fragment (isolated from the IE1 gene) into the BstXI site of the human c-jun gene. The primers used to amplify the c-jun fragment were 5h AGATGCCCGGCGAGACACCG 3h and 5h AGCCCCCGACGGTCTCTCTT 3h. A 314 bp fragment from c-jun and a 560 bp fragment from the competitive template were produced with these primers. The primers used for β-actin were 5h GCCGAGCGGGAAATCGTGCG 3h and 5h ACGATGGAGGGGCCGGACTC 3h, which amplified a 500 bp fragment. The c-fos gene was kindly provided by M. Yoshida (Institute of Medical Science, University of Tokyo, Japan), and the c-jun gene by T. Deng (University of Florida, Gainesville, USA).
Results IE1 activates transcription from a promoter containing AP-1-binding sites
To test whether IE1 activates AP-1, we transfected cells with an AP-1 reporter plasmid (AP-1 CAT) containing a CAT
AP-1 activation by HCMV IE1 (a)
(b)
Fig. 1. Effects of IE1 on cellular transcription factors AP-1, Sp1 and Egr-1. (a) Reporter plasmids. The AP-1 reporter plasmid (AP-1 CAT) contains a bacterial CAT gene under the control of a truncated c-fos promoter and five consensus AP-1-binding sites. The truncated c-fos promoter (∆56) contains 56 bp upstream of the RNA start site, and the TATA box is its only transcriptional element. The Sp1 reporter plasmid (tk CAT9) contains two copies of a synthetic oligonucleotide derived from GC boxes III and IV of the SV40 early promoter, approximately 50 bp upstream of the transcriptional start site of a truncated HSV tk promoter (k37tk CAT). The Egr-1 reporter plasmid (PDGF-A CAT) was constructed by fusing a PDGF-A promoter to a CAT gene. (b) IE1 activates AP-1-driven transcription. U373MG or U937 cells were transfected with 3 µg of the various reporter plasmids, together with 3 µg of the IE1 expression plasmid pRSV-IE1 or the control plasmid pRc/RSV, by using the DEAE–dextran method. For CAT assays, 100 µg protein was incubated with [14C]chloramphenicol for 1 h at 37 mC. The results shown here are the means of five independent transfection assays.
Fig. 2. Effect of mutant IE1s on AP-1. U937 cells were transfected with 3 µg AP-1 reporter plasmid and 3 µg IE1 deletion expression plasmids. CAT assays were performed as described in Fig. 1. The results are the means of three independent transfection assays.
gene fused to a promoter with AP-1-binding sites upstream of a truncated c-fos promoter (Fig. 1 a). Transient expression of the CAT enzyme was used to measure the inducibility of AP1 by IE1. As controls, we also measured the inducibility of Sp1 and Egr-1 by using similar reporter plasmids containing binding sites for these transcription factors (Courey et al., 1989 ; Khachigian et al., 1995). These reporter plasmids were
transfected into the human microglial cell line U373MG and the human promonocytic cell line U937, together with the IE1 expression plasmid pRSV-IE1. When various reporter plasmids were co-transfected with pRc\RSV (lacking IE1), the levels of CAT activity were very low. However, co-transfection with pRSV-IE1 resulted in a large increase in CAT activity from the AP-1 reporter plasmid, while it had no significant effect on CAT expression from a control promoter lacking the AP-1binding sites (Fig. 1 b). As a further control, we used pRc\RSV containing the IE1 sequence in the antisense orientation. This plasmid had no effect on CAT expression driven by any of the promoters described above (data not shown). These data indicated that IE1 could activate transcription from promoters containing AP-1-, but not Sp1- or Egr-1-binding sites. We also tested the effect of previously characterized IE1 mutants (Lafemina et al., 1989) on activation of AP-1. Plasmids expressing mutant IE1 were transfected to U937 cells together with the AP-1 reporter plasmid. Results of AP-1 activation were compared between wild-type and mutant IE1s. No mutant IE1s induced AP-1-dependent transcription (Fig. 2). This result is consistent with previous reports suggesting that domains responsible for transcriptional activation are spread over the IE1 protein (Lafemina et al., 1989 ; Stenberg et al., 1990). In order to perform more quantitative analyses, we constructed cell lines stably expressing IE1. U373MG cells and U937 cells were transduced by a retroviral vector, LNC-gIE1, containing the IE1 gene. The parental vector lacking the IE1 sequence, LNCX, was used as a negative control. Following selection in G418, drug-resistant cells were subcloned and more than 12 subclones were derived from each of the U937 JGD
S. Kim and others (a)
(b)
Fig. 3. (a) Expression of IE1 proteins in U937 IE1 subclones. Whole-cell extracts were subjected to 8 % SDS–PAGE and electroblotted onto PVDF membrane (Gelman). Immunoblotting was performed with an anti-IE1 monoclonal antibody against exon 2 and 3 (MAB810 ; Chemicon). The blot was visualized by chemiluminescence by using peroxidase-labelled anti-mouse antibody (Amersham). Lane 1, LNCX cells ; 2, IE1-2 cells ; 3, IE1-3 cells. (b) AP-1-driven transcription is increased in U373MG and U937 cells expressing IE1 constitutively. Two µg reporter plasmid was transfected into IE1 or LNCX cells and 20 µg protein was analysed. The means of five independent assays are presented.
(a) c-fos
(b) c-jun
(c) β-actin
Fig. 4. Quantitative analysis of mRNA expression of AP-1 subunits in cells expressing IE1 and control cells. Competitor DNAs have binding sites for the PCR primers but contain additional sequences, so that larger-sized products were produced. For U937 cells, PCR template was cDNA from : LNCX cells (k, lanes 1, 5, 9) ; IE1-2 cells (j, lanes 2, 6, 10) ; IE1-3 cells (j, lanes 3, 7, 11) ; and PMA-treated LNCX cells (P, lanes 4, 8, 12). For U373MG cells, PCR template was cDNA from : LNCX-2 cells (k, lanes 1, 5, 9) ; IE1-1 cells (j, lanes 2, 6, 10) ; IE1-2 cells (j, lanes 3, 7, 11) ; and PMA-treated LNCX-2 cells (P, lanes 4, 8, 12). The result shown here is representative of more than five independent assays.
JGE
AP-1 activation by HCMV IE1
IE1 does not have a significant effect on the levels of c-fos and c-jun mRNA
To test whether the increase in AP-1 activity induced by IE1 was due to overexpression of AP-1 components, we compared the amounts of mRNA for c-fos and c-jun in various IE1-expressing subclones. Because the levels of c-fos and c-jun mRNA were too low to be detected by conventional Northern blot hybridization analysis, a quantitative RT–PCR method was used. Total RNAs were prepared from two IE1-expressing subclones and one control subclone from both U373MG and U937 cells, followed by RT–PCR. For quantitative analysis, serially diluted competitors of c-fos and c-jun were added to the fixed amount of cDNA in the PCR reaction. As a control, βactin RNA was also amplified. When the control cells were treated with PMA, levels of c-fos and c-jun mRNA were significantly increased (Fig. 4 a, b ; compare lane 5 with lane 8). However, the ratio of target to competitor products was reproducibly identical for a given amount of competitor between IE1-expressing and control cells (Fig. 4 a, b ; for example, compare lane 5 with lanes 6 and 7). The same experiments were performed with several other subclones and similar results were obtained (data not shown). These results indicated that the levels of c-fos and c-jun mRNA were not changed by expression of IE1 and that IE1 might regulate AP1 at the post-transcriptional level. Protein kinase inhibitors suppress IE1 activation of AP-1 in a cell type-dependent manner
Some mitotic stimuli, such as phorbol esters and growth factors, activate AP-1 through the protein kinase C (PKC) pathway, while other reagents, such as transforming growth factor (TGF) and cyclic AMP, seem to control AP-1 independently of PKC (Muller et al., 1989).
1.5
Relative CAT activity
Relative CAT activity
U373MG U937
1.0
0.5
1.5
1.0 0.5
2 4 6 8 10 12 GF109203X (µM)
20 40 60 80 100 120 Staurosporine (nM) 1.5
Relative CAT activity
Relative CAT activity
and U373MG populations. The expression of IE1 in the subclones was confirmed by Western blot analysis with a monoclonal antibody specific for an epitope present in exons 2 and 3 of IE1. More than six subclones from each cell line were found to express IE1. Two representative subclones derived from U937, IE1-2 and IE1-3, expressed a protein of approximately 72 kDa, which was not present in the control cell line U937 LNCX (Fig. 3 a), and were used in subsequent analysis. Both IE1-expressing and control cells (U373MG and U937 cells) were transfected with the AP-1, Sp1 and Egr-1 reporter plasmids. Transfection of these reporter plasmids alone or their respective control plasmids resulted in very low levels of CAT activity in cells lacking the IE1 protein. However, transfection of the AP-1 reporter plasmid into cells expressing IE1 always resulted in a dramatic increase in CAT activity (Fig. 3 b). Again, IE1 had no significant effect on CAT expression from the Sp1 or Egr-1 reporter plasmids. These results confirmed that IE1 could induce AP-1-driven transcription.
1.0
0.5
20 40 60 80 100 120 HA1004 (µM)
1.5
1.0 0.5
10
20 30 H7 (µM)
40
Fig. 5. Effect of protein kinase inhibitors on induction of AP-1 by IE1. Inhibition of protein kinase activity was performed with GF109203X, staurosporine, HA1004 and H7. GF109203X (10 mM) and staurosporine (100 µM) were dissolved in DMSO and HA1004 (10 mM) and H7 (10 mM) were dissolved in water. Cells expressing IE1 were transfected with 2 µg AP-1 reporter plasmid and 6 h later were treated with protein kinase inhibitors at the concentrations indicated. Cells were harvested 48 h after transfection and CAT assays were performed with 20 µg protein. The results shown here are the means of three independent experiments.
To investigate the involvement of protein kinases in the IE1 activation of AP-1, we tested the effects of various protein kinase inhibitors. Several IE1-expressing subclones were transfected with the AP-1 reporter plasmid and were treated with the PKC-specific inhibitor GF109203X (bisindolylmaleimide I) (Toullec et al., 1991), the general protein kinase inhibitor staurosporine (Tamaoki et al., 1986), the protein kinase A (PKA) inhibitor HA1004 [N-(2-guanidinoethyl)-5-isoquinolinesulfonamide] (Asano & Hidaka, 1984) and the PKC and PKA inhibitor H7 [1-(5-isoquinolinesulfonyl)-2-methylpiperazine] (Hidaka et al., 1984). The results from one representative subclone from U373MG and U937 cells expressing IE1 are shown in Fig. 5. In U373MG cells expressing IE1, AP-1 activity was blocked efficiently by 10 nM staurosporine but not by GF109203X, HA1004 or H7 (Fig. 5). In contrast, in U937 cells expressing IE1, staurosporine did not have any effect, even at a high concentration, while 5 µM H7 blocked AP-1 activation almost completely. These results suggested that a protein kinase(s) other than PKC and PKA might be involved in AP-1 activation by IE1, and that the mechanism by which IE1 activates AP-1 might differ between the two cell types. JGF
S. Kim and others (a)
(b)
Fig. 6. Effects of Ras, MEKK1, MKK4 and JNK1 on AP-1 activation by IE1. (a) U937 LNCX and IE1 cells were transfected with 0n5 µg AP-1 reporter plasmid together with 8 µg either control vector (pSRα-puro) or expression vectors for Ras (pSRα-Raspuro), MEKK1 (pSRα-MEKK1-puro), MKK4 (pSRα-MKK4-puro) or JNK1 (pSRα-JNK1-puro). (b) As a control, the same experiment was performed with the Egr-1 reporter plasmid. The results shown here are the means of five independent transfection assays.
MEKK1 has a highly synergistic effect on AP-1 activation by IE1
AP-1 activity can be modulated through phosphorylation. It is well established that some of the mammalian mitogenactivated protein kinase (MAPK) pathways regulate AP-1 activity (Cano & Mahadevan, 1995 ; Karin, 1995). The [Raf-1 MAPK\extracellular signal-regulated kinase kinase1 (MEK1) extracellular signal-regulated kinase 1, 2 (ERK 1, 2)] pathway induces c-Fos by activating the c-fos promoter through a serum response element (SRE), while the [MEKK1 MAPK kinase 4 (MKK4) c-Jun N-terminal kinase (JNK)] pathway activates c-Jun by phosphorylating c-Jun at its N terminus. Based on the above results from quantitative RT–PCR and protein kinase inhibitor assays, we tested the possible involvement of the [MEKK1 MKK4 JNK] pathway in the IE1 activation of AP-1. U937 IE1 cells and LNCX cells were transfected with plasmids expressing Ras, MEKK1, MKK4 or JNK1, together with the AP-1 reporter plasmid. Co-transfection of an expression vector for MKK4 or JNK1 appeared to have little effect on AP-1 activation by IE1, while Ras increased the level of CAT activity by an average of 2-fold. Cotransfection of an MEKK1 expression vector had a reproducible dramatic effect, resulting in an average 10-fold increase in the level of CAT activity (Fig. 6 a). This increase by MEKK1 occurred in a dose-dependent manner (data not shown). To be certain that this observation was specific for IE1, we performed a similar experiment with the Egr-1 reporter plasmid (PDGF-A CAT). IE1 did not increase transcription from this promoter, and none of the above expression vectors had any positive effect on the level of CAT activity (Fig. 6 b). To identify the regions of MEKK1 responsible for IE1 activation of AP-1, we used two previously characterized mutants, KMMEKK, containing a point mutation (K432M) in the catalytic domain and MEKK∆N, lacking the entire JGG
Fig. 7. Effect of mutant MEKK1s on AP-1 activation by IE1. U937 IE1 cells and LNCX cells were transfected with 0n5 µg AP-1 reporter plasmid together with 8 µg control vector (pSRα-puro) or expression vectors for a dominant-negative mutant of MEKK1 (pSRα-KMMEKK-puro), a truncated MEKK (pSRα-MEKK∆N-puro) or MEKK1 (pSRα-MEKK1-puro). Twenty µg protein was used in the CAT reaction. The result shown here is the mean of five independent transfection assays.
regulatory domain (Minden et al., 1994). As shown in Fig. 7, KMMEKK had no significant effect on AP-1 activation by IE1, while MEKK∆N could act synergistically with IE1 to a slightly greater degree than parental MEKK1. This result indicated that the kinase domain was sufficient for the synergistic effect of MEKK1 on AP-1 activation by IE1.
Discussion We have demonstrated that the IE1 protein of HCMV activates transcription efficiently from a promoter containing AP-1-binding sites, and that this activation does not occur at
AP-1 activation by HCMV IE1
the transcriptional level. Although transcription was increased from the AP-1 reporter plasmid in transfection assays, we found by electrophoretic mobility shift assay that AP-1 DNAbinding activity was not increased by IE1 expression (data not shown). Based on the results from experiments with protein kinase inhibitors, we suggest that IE1 activates AP-1 probably through modulation of a protein kinase(s), but different protein kinases may be involved in different cell types. Our data suggest that MEKK1 may be a key factor in this process. One possible mechanism for IE1 activation of AP-1 is that IE1 interacts directly with c-Fos or c-Jun and thereby modulates AP-1 activity. By various techniques, we tested whether IE1 binds to c-Fos or c-Jun, but failed to find direct association between the two proteins (data not shown). We propose two possible mechanisms involving protein kinase(s) in AP-1 activation by IE1. Firstly, IE1 itself may require phosphorylation by a protein kinase(s) for its function. Although IE1 has been shown to be a nuclear phosphoprotein, it is not yet clear whether phosphorylation is essential for its function. Because MEKK1 has recently also been shown to be present in the nucleus (Fanger et al., 1997), it may phosphorylate IE1 in the nucleus. Alternatively, a protein kinase(s) regulated by MEKK1 could phosphorylate IE1. Secondly, IE1 may control a protein kinase(s) that regulates cJun or c-Fos, resulting in activation of AP-1. Because the IE1 protein is present in the nucleus as well as in the cytosol (Otto et al., 1988), it is possible that IE1 may activate a cytosolic protein kinase(s) or a nuclear protein kinase(s). IE1 is known to have a kinase activity and this activity is required for transcription (Pajovic et al., 1997). Therefore, IE1 might regulate a cellular kinase(s) by phosphorylating it. We are currently testing these possibilities. It is well established that AP-1 activity can be regulated at both the transcriptional and the post-transcriptional levels (Angel & Karin, 1991 ; Angel & Herrlich, 1994 ; Karin, 1995). Several viral proteins, such as hepatitis B virus pX, Epstein–Barr virus latent membrane protein-1 and polyoma virus middlesized tumour antigen, have been shown to activate AP-1 (Scho$ nthal et al., 1992 ; Benn et al., 1996 ; Kieser et al., 1997). However, the underlying mechanism appears to be different depending on the activation protein. Polyoma virus middlesized tumour antigen activates AP-1 by increasing c-jun expression, Epstein–Barr virus latent membrane protein-1 upregulates AP-1 via the JNK cascade and hepatitis B virus pX induces AP-1 activity by increasing the level of c-fos mRNA and by stimulating protein kinases. Our data show that IE1 may employ an additional method of controlling AP-1. Therefore, all these DNA viruses have evolved to regulate AP1, probably for their own benefit. Indeed, these DNA viruses can grow much more efficiently when the host cell is in an ‘ activated ’ state, in which AP-1 is critically involved. AP-1 is a pleiotropic transcription factor that regulates many important genes involved in the immune response, cell differentiation and tumorigenesis. Induction of this factor by
the IE1 protein may lead to the activation of cellular genes important for HCMV itself, and also cause the activation of other viruses residing in the same cells, such as human immunodeficiency virus (HIV). Indeed, a direct effect of HCMV superinfection on HIV-1 replication has been demonstrated (Ho et al., 1990). Furthermore, increased activity of AP-1 may disrupt normal cellular functions and lead eventually to uncontrolled cell growth, inflammation and tumorigenesis. Because HCMV is prevalent in the human population and we have shown IE1 to be a potent activator of the important cellular transcription factor AP-1, it is important to understand more about how IE1 expression activates AP-1 at the molecular level, and to identify the putative protein kinase(s) that is involved. We thank Mitsuaki Yoshida, Gary S. Hayward, Roger J. Davis, Kentaro Semba and Tiliang Deng for providing us with plasmids. This work was supported in part by grants from the Korea Science and Engineering Foundations (96-0403-03-01-3 ; S. K.) and the Korea Ministry of Science and Technology (G7 Project 08-02-02 ; S. K.).
References Angel, P. & Karin, M. (1991). The role of Jun, Fos and the AP-1 complex
in cell-proliferation and transformation. Biochimica et Biophysica Acta 1072, 129–157. Angel, P. & Herrlich, P. A. (editors) (1994). The FOS and JUN Families of Transcription Factors. Boca Raton : CRC Press. Asano, T. & Hidaka, H. (1984). Vasodilatory action of HA1004 [N-(2guanidinoethyl)-5-isoquinolinesulfonamide], a novel calcium antagonist with no effect on cardiac function. Journal of Pharmacology and Experimental Therapeutics 231, 141–145. Benn, J., Su, F., Doria, M. & Schneider, R. J. (1996). Hepatitis B virus HBx protein induces transcription factor AP-1 by activation of extracellular signal-regulated and c-Jun N-terminal mitogen-activated protein kinases. Journal of Virology 70, 4978–4985. Biegalke, B. J. & Geballe, A. P. (1991). Sequence requirements for activation of the HIV-1 LTR by human cytomegalovirus. Virology 183, 381–385. Boldogh, I., AbuBakar, S. & Albrecht, T. (1990). Activation of protooncogenes : an immediate early event in human cytomegalovirus infection. Science 247, 561–564. Boldogh, I., AbuBakar, S., Deng, C. Z. & Albrecht, T. (1991).
Transcriptional activation of cellular oncogenes fos, jun, and myc by human cytomegalovirus. Journal of Virology 65, 1568–1571. Boldogh, I., Fons, M. P. & Albrecht, T. (1993). Increased levels of sequence-specific DNA-binding proteins in human cytomegalovirusinfected cells. Biochemical and Biophysical Research Communications 197, 1505–1510. Cano, E. & Mahadevan, L. C. (1995). Parallel signal processing among mammalian MAPKs. Trends in Biochemical Sciences 20, 117–122. Cherrington, J. M. & Mocarski, E. S. (1989). Human cytomegalovirus ie1 transactivates the α promoter-enhancer via an 18-base-pair repeat element. Journal of Virology 63, 1435–1440. Courey, A. J., Holtzman, D. A., Jackson, S. P. & Tjian, R. (1989).
Synergistic activation by the glutamine-rich domains of human transcription factor Sp1. Cell 59, 827–836. JGH
S. Kim and others Davis, M. G., Kenney, S. C., Kamine, J., Pagano, J. S. & Huang, E.-S. (1987). Immediate-early gene region of human cytomegalovirus trans-
Margolis, M. J., Pajovic, S., Wong, E. L., Wade, M., Jupp, R., Nelson, J. A. & Azizkhan, J. C. (1995). Interaction of the 72-kilodalton human
activates the promoter of human immunodeficiency virus. Proceedings of the National Academy of Sciences, USA 84, 8642–8646.
cytomegalovirus IE1 gene product with E2F1 coincides with E2Fdependent activation of dihydrofolate reductase transcription. Journal of Virology 69, 7759–7767.
De! rijard, B., Raingeaud, J., Barrett, T., Wu, I. H., Han, J., Ulevitch, R. J. & Davis, R. J. (1995). Independent human MAP-kinase signal
transduction pathways defined by MEK and MKK isoforms. Science 267, 682–685. Fanger, G. R., Johnson, N. L. & Johnson, G. L. (1997). MEK kinases are regulated by EGF and selectively interact with Rac\Cdc42. EMBO Journal 16, 4961–4972. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Molecular and Cellular Biology 2, 1044–1051. Grosschedl, R. & Baltimore, D. (1985). Cell-type specificity of immunoglobulin gene expression is regulated by at least three DNA sequence elements. Cell 41, 885–897. Hagemeier, C., Walker, S. M., Sissons, P. J. G. & Sinclair, J. H. (1992).
The 72K IE1 and 80K IE2 proteins of human cytomegalovirus independently trans-activate the c-fos, c-myc and hsp70 promoters via basal promoter elements. Journal of General Virology 73, 2385–2393. Hayhurst, G. P., Bryant, L. A., Caswell, R. C., Walker, S. M. & Sinclair, J. H. (1995). CCAAT box-dependent activation of the TATA-less
human DNA polymerase α promoter by the human cytomegalovirus 72kilodalton major immediate-early protein. Journal of Virology 69, 182–188. Hidaka, H., Inagaki, M., Kawamoto, S. & Sasari, Y. (1984). Isoquinolinesulfonamides, novel and potent inhibitors of cyclic nucleotide dependent protein kinase and protein kinase C. Biochemistry 23, 5036–5041. Hirano, M., Osada, S., Aoki, T., Hirai, S., Hosaka, M., Inoue, J. & Ohno, S. (1996). MEK kinase is involved in tumor necrosis factor α-induced
Michelson, S., Alcami, J., Kim, S. J., Danielpour, D., Bachelerie, F., Picard, L., Bessia, C., Paya, C. & Virelizier, J. L. (1994). Human
cytomegalovirus infection induces transcription and secretion of transforming growth factor β1. Journal of Virology 68, 5730–5737. Miller, A. D., Miller, D. G., Garcia, J. V. & Lynch, C. M. (1993). Use of retroviral vectors for gene transfer and expression. Methods in Enzymology 217, 581–599. Minden, A., Lin, A., McMahon, M., Lange-Carter, C., De! rijard, B., Davis, R. J., Johnson, G. L. & Karin, M. (1994). Different activation of ERK and
JNK mitogen-activated protein kinases by Raf-1 and MEKK. Science 266, 1719–1723. Mocarski, E. S., Jr (1996). Cytomegaloviruses and their replication. In Fields Virology, 3rd edn, pp. 2447–2492. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia : Lippincott–Raven. Monick, M. M., Geist, L. J., Stinski, M. F. & Hunninghake, G. W. (1992).
The immediate early genes of human cytomegalovirus upregulate expression of the cellular genes myc and fos. American Journal of Respiratory Cell and Molecular Biology 7, 251–256. Muller, U., Roberts, M. P., Engel, D. A., Doerfler, W. & Shenk, T. (1989). Induction of transcription factor AP-1 by adenovirus E1A
protein and cAMP. Genes and Development 3, 1991–2002. Otto, S. M., Sullivan-Tailyour, G., Malone, C. L. & Stinski, M. F. (1988).
Subcellular localization of the major immediate early protein (IE1) of human cytomegalovirus at early times after infection. Virology 162, 478–482. Pajovic, S., Wong, E. L., Black, A. R. & Azizkhan, J. L. (1997).
Ho, W.-Z., Harouse, J. M., Rando, R. F., Go$ nczo$ l, E., Srinivasan, A. & Plotkin, S. A. (1990). Reciprocal enhancement of gene expression and
Identification of a viral kinase that phosphorylates specific E2Fs and pocket proteins. Molecular and Cellular Biology 17, 6459–6464. Robbins, P. D., Horowitz, J. M. & Mulligan, R. C. (1990). Negative regulation of human c-fos expression by the retinoblastoma gene product. Nature 346, 668–671.
viral replication between human cytomegalovirus and human immunodeficiency virus type 1. Journal of General Virology 71, 97–103.
Sambucetti, L. C., Cherrington, J. M., Wilkinson, G. W. & Mocarski, E. S. (1989). NF-κB activation of the cytomegalovirus enhancer is
Ikeuchi, K., Kim, S., Byrn, R. A., Goldring, S. R. & Groopman, J. E. (1990). Infection of nonlymphoid cells by human immunodeficiency
mediated by a viral transactivator and by T cell stimulation. EMBO Journal 8, 4251–4258. Scho$ nthal, A., Srinivas, S. & Eckhart, W. (1992). Induction of c-jun protooncogene expression and transcription factor AP-1 activity by the polyoma virus middle-sized tumor antigen. Proceedings of the National Academy of Sciences, USA 89, 4972–4976. Scully, A. L., Sommer, M. H., Schwartz, R. & Spector, D. H. (1995). The human cytomegalovirus IE2 86-kilodalton protein interacts with an early gene promoter via site-specific DNA binding and protein–protein associations. Journal of Virology 69, 6533–6540.
NF-κB activation and degradation of IκB-α. Journal of Biological Chemistry 271, 13234–13238.
virus type 1 or type 2. Journal of Virology 64, 4226–4231. Karin, M. (1995). The regulation of AP-1 activity by mitogen-activated protein kinases. Journal of Biological Chemistry 270, 16483–16486. Khachigian, L. M., Williams, A. J. & Collins, T. (1995). Interplay of Sp1 and Egr-1 in the proximal platelet-derived growth factor A-chain promoter in cultured vascular endothelial cells. Journal of Biological Chemistry 270, 27679–27686. Kieser, A., Kilger, E., Gires, O., Ueffing, M., Kolch, W. & Hammerschmidt, W. (1997). Epstein–Barr virus latent membrane
protein-1 triggers AP-1 activity via the c-Jun N-terminal kinase cascade. EMBO Journal 16, 6478–6485. Kim, S., Yu, S. S. & Kim, V. N. (1996). Essential role of NF-κB in transactivation of the human immunodeficiency virus long terminal repeat by the human cytomegalovirus IE1 protein. Journal of General Virology 77, 83–91. Lafemina, R. L., Pizzorno, M. C., Mosca, J. D. & Hayward, G. S. (1989).
Expression of the acidic nuclear immediate-early protein (IE1) of human cytomegalovirus in stable cell lines and its preferential association with metaphase chromosomes. Virology 172, 584–600. JGI
Soneoka, Y., Cannon, P. M., Ramsdale, E. E., Griffiths, J. C., Romano, G., Kingsman, S. M. & Kingsman, A. J. (1995). A transient three-
plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Research 23, 628–633. Stenberg, R. M., Fortney, J., Barlow, S. W., Magrane, B. P., Nelson, J. A. & Ghazal, P. (1990). Promoter-specific trans activation and
repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains. Journal of Virology 64, 1556–1565. Stinski, M. F., Thomsen, D. R., Stenberg, R. M. & Goldstein, L. C. (1983). Organization and expression of the immediate early genes of
human cytomegalovirus. Journal of Virology 46, 1–14.
AP-1 activation by HCMV IE1 Tamaoki, T., Nomoto, H., Takahashi, I., Kato, Y., Morimoto, M. & Tomita, F. (1986). Staurosporine, a potent inhibitor of phospholipid\
Ca++ dependent protein kinase. Biochemical and Biophysical Research Communications 135, 397–402. Tevethia, M. J., Spector, D. J., Leisure, K. M. & Stinski, M. F. (1987).
Participation of two human cytomegalovirus immediate early gene regions in transcriptional activation of adenovirus promoters. Virology 161, 276–285. Toullec, D., Pianetti, P., Coste, H., Bellevergue, P., Grand-Perret, T., Ajakane, M., Baudet, V., Boissin, P., Boursier, E., Loriolle, F. and
others (1991). The bisindolylmaleimide GF 109203X is a potent and
selective inhibitor of protein kinase C. Journal of Biological Chemistry 266, 15771–15781. Yurochko, A. D., Kowalik, T. F., Huong, S. M. & Huang, E. S. (1995).
Human cytomegalovirus upregulates NF-κB activity by transactivating the NF-κB p105\p50 and p65 promoters. Journal of Virology 69, 5391–5400.
Received 26 August 1998 ; Accepted 12 November 1998
JGJ
Human cytomegalovirus IE1 protein activates AP-1 through a cellular protein kinase(s) Sujeong Kim,1 Seung Shin Yu,2 Im Soon Lee,2 Shigeo Ohno,3 Jeongbin Yim,1 Sunyoung Kim2 and Hyen Sam Kang1 1, 2
Department of Microbiology, College of Natural Sciences1 and Institute for Molecular Biology and Genetics2, Seoul National University, Seoul 151-742, Korea 3 Department of Molecular Biology, Yokohama City University School of Medicine, Yokohama 236, Japan
During human cytomegalovirus (HCMV) infection, a rapid increase in AP-1 activity is detected. In this study, activation of transcription from promoters containing AP-1-binding sites by the IE1 protein of HCMV was examined. In transient transfection assays with reporter plasmids, it was found that IE1 strongly induced AP-1-driven transcription. Cells stably expressing IE1 also showed higher levels of AP-1 activity than did control cells. IE1 expression did not raise levels of c-jun and c-fos RNA, as determined by quantitative RT–PCR. AP-1 induction by IE1 was blocked efficiently by protein kinase inhibitors in a cell type-dependent manner ; for example, by staurosporine in the human microglial cell line U373MG and by H7 in the human promonocytic cell line U937. IE1driven activation of AP-1 was increased dramatically by mitogen-activated protein kinase/ extracellular signal-regulated kinase kinase kinase 1 (MEKK1). The results of this study indicate that IE1 activates AP-1 at the post-transcriptional level and that MEKK1 may play an important role in this process.
Introduction Human cytomegalovirus (HCMV) is a member of the subfamily Betaherpesvirinae, and is endemic in the human population. HCMV genes are expressed in a temporally regulated manner upon infection of permissive cells, dividing the virus life-cycle into three stages : immediate-early (IE), early and late (Mocarski, 1996). The IE genes encode the first set of proteins expressed upon infection, some of which are involved in ‘ fine-tuning ’ of the virus life-cycle. IE1 originates from the major IE region under the control of the major IE promoter. At least five exons are spliced alternatively from the major IE region, producing IE1 and IE2 (Stinski et al., 1983). A single mRNA species of 1n95 kb is transcribed for the 72 kDa IE1 protein, while there are multiple mRNAs for IE2, resulting in proteins of 86, 55 and 40 kDa. Transcripts for the IE1 and IE2 proteins share the first three exons, but differ in the structure of the last exons. The IE1 protein activates transcription from both homologous and heterologous viral and cellular promoters (Davis et al., 1987 ; Author for correspondence : Sunyoung Kim. Fax j82 2 875 0907. e-mail sunyoung!plaza.snu.ac.kr
0001-5926 # 1999 SGM
Tevethia et al., 1987 ; Cherrington & Mocarski, 1989 ; Sambucetti et al., 1989 ; Hagemeier et al., 1992 ; Michelson et al., 1994 ; Hayhurst et al., 1995 ; Margolis et al., 1995 ; Yurochko et al., 1995). AP-1 is a transcription factor composed of members of the Jun and Fos families (Angel & Karin, 1991 ; Angel & Herrlich, 1994). These proteins associate to form a variety of homo- and heterodimers that bind to a common site. The fine tuning of AP-1 activity is important for flexible regulation of cell growth, differentiation and development in response to different stimuli. It has been reported previously that induction of c-fos and c-jun, the major subunits of AP-1, occurs after HCMV infection (Boldogh et al., 1990, 1991, 1993 ; Hagemeier et al., 1992). AP-1 was found to be modulated in two phases during HCMV infection. At very early times after infection, there was a rapid increase in c-fos and c-jun that was not affected by either inactivation of the virus or inhibition of protein synthesis (Boldogh et al., 1990, 1991). These data indicated that activation of AP-1 was independent of de novo expression of HCMV IE proteins and possibly involved the interaction of viral particles with the cell. The second phase of the increase in c-fos RNA was detected 12 h post-infection (Hagemeier et al., 1992) and the HCMV IE products, IE1 and JGB
S. Kim and others
IE2, were implicated (Hagemeier et al., 1992 ; Monick et al., 1992). IE2 was also shown to activate the HCMV early promoter via an AP-1-binding site (Scully et al., 1995). However, the precise mechanism of activation of AP-1 by IE proteins is not yet understood completely. In this report, we present data showing that IE1 can upregulate the activity of AP-1 efficiently. Mitogen-activated protein kinase\extracellular signal-regulated kinase kinase kinase 1 (MEKK1), one of the protein kinases regulating AP-1 activity, acted synergistically with IE1 in transactivating AP-1. These results suggest that IE1 activates AP-1 through a protein kinase(s) involved in the cellular signal transduction pathway.
Methods
Cell culture. The human microglial cell line U373MG was grown in DMEM (Gibco BRL) supplemented with 10 % foetal bovine serum (Gibco BRL), 100 U\ml penicillin and 100 µg\ml streptomycin under 5 % CO in # a humidified incubator at 37 mC. The human promonocytic cell line U937 was grown in RPMI 1640 medium (Sigma) supplemented with 10 % foetal bovine serum, 100 U\ml penicillin and 100 µg\ml streptomycin.
Plasmids. The IE1 expression plasmid pRSV-IE1 was described previously (Kim et al., 1996). Other IE1 expression plasmids, pEQ336 and pEQ273 (Biegalke & Geballe, 1991), were provided by A. Geballe (Dept of Laboratory Medicine, University of Washington, Seattle, USA) and pRL60, pRL61 and pRL74 (Lafemina et al., 1989) were provided by G. S. Hayward (Johns Hopkins School of Medicine, Baltimore, USA). ∆56 fos CAT was kindly provided by J. Pierce (Harvard Medical School, Cambridge, USA), AP-1 CAT (Robbins et al., 1990) by P. D. Robbins (University of Pittsburgh, USA), k37tk CAT and tk CAT 9 by A. Courey (Dept of Chemistry and Biochemistry, University of California, Los Angeles, USA) and PDGF-A CAT by K. Semba (Institute of Medical Science, University of Tokyo, Japan). For high-level expression of kinase genes in U373MG and U937 cells, pSRα-puro was constructed by replacing the CMV promoter (BglII\PstI) and the SV40 promoter and neomycin-resistance (Neor) gene (PvuII\SfuI) of pCI-neo (Promega) with the SRα promoter, the mouse mammary tumour virus long terminal repeat and a puromycin-resistance gene. Expression vectors for Ras, MEKK1, KMMEKK, JNK1 and MKK4 were constructed by inserting appropriate fragments into appropriate restriction sites of pSRα-puro : a 560 bp BamHI fragment from pCEV4 c-ki-Ras into the SmaI site for SRαc-ki-Ras-puro, a 2 kbp EcoRI fragment from SRD-MEKK into the EcoRI site for SRα-MEKK-puro, a 2 kbp EcoRI fragment from S KMMEKK P6 into the EcoRI site for SRα-KMMEKK-puro, a 1n2 kbp BglII fragment from SR His-JNK1 into the SmaI site for SRα-JNK1-puro and a 1n2 kbp BamHI\XbaI fragment from pcDNA3-FlagMKK4 into the EcoRI\XbaI sites for SRα-MKK4-puro. An expression vector for the catalytic domain of MEKK1, pSRα-MEKK∆N-puro, was constructed by inserting a 1 kbp NcoI\NotI fragment from SRα-MEKK-puro into the SmaI\NotI site of pSRα-puro. pCEV4 c-ki-Ras, SRD-MEKK, S KM MEKK P6 and SR HisJNK1 were described previously (Hirano et al., 1996) and pcDNA3FlagMKK4 (De! rijard et al., 1995) was a gift of R. Davis (University of Massachusetts Medical School, Worcester, USA).
Transfections and CAT assays. For transient expression assays, U373MG cells were transfected by the DEAE–dextran method, as described previously (Ikeuchi et al., 1990). U937 cells were transfected by the DEAE–dextran method as modified by Grosschedl & Baltimore (1985). Transfection efficiency was examined by co-transfection of 1 µg JGC
of a control plasmid that contained the β-galactosidase gene. CAT activity was determined according to a standard method (Gorman et al., 1982). The amount of acetylation was quantified by phosphorimager (Fuji).
Construction of cells stably expressing IE1. To construct a retroviral vector expressing IE1, a 2n9 kbp HindIII\ClaI fragment from pRSV-IE1 was subcloned into HindIII\ClaI-digested LNCX (Miller et al., 1993), resulting in LNC-gIE1. LNC-gIE1 was transfected into 293T cells, together with expression vectors for amphotropic Moloney-murine leukaemia virus env (pHIT456) and gag-pol (pHIT60), by the calciumphosphate method, as described elsewhere (Soneoka et al., 1995). The parental retroviral vector LNCX was used as a negative control. At 48 h post-transfection, virus supernatants were harvested and filtered through a 0n45 µm filter. U373MG and U937 cells were transduced by the retroviral vectors in the presence of 8 µg\ml polybrene, and G418 (1 mg\ml) was added 24 h after transduction. This medium was changed every 3 days and selection was continued for a further 4 weeks. G418resistant U373MG cells were subcloned by using a cloning cylinder. For U937 cells, resistant cells were subcloned by limiting dilution. The presence of IE1 was confirmed in both cells by Western blot analysis, immunoprecipitation and immunofluorescence with a monoclonal antibody that can detect IE1 (MAB810 ; Chemicon).
RNA preparation and quantitative RT–PCR. Total cellular RNA was isolated by using Trizol reagent (Gibco BRL) according to the manufacturer’s instructions. For a positive control, LNCX cells (U373MG and U937 cells) were treated with phorbol 12-myristate 13-acetate (PMA) (50 ng\ml) for 2 h. RNA (2 µg) was reverse-transcribed by using AMV reverse transcriptase (Promega) and 2 µg oligo(dT) primer (Pharmacia). The resulting cDNA was diluted to a final volume of 150 µl and 10 µl of the diluted cDNA was used in a PCR reaction. In addition to the cDNA, the reaction mixture included 2n5 units ExTaq polymerase (Takara), 200 nM each primer and 0n25 mM each dNTP in 50 µl. The reaction was incubated for 30 cycles of 94 mC for 1 min, 65 mC for 1 min and 72 mC for 90 s. The levels of c-fos and c-jun RNA were quantified by competitive PCR with their respective competitors. The competitive template for c-fos was generated by insertion of a 296 bp heterologous DNA fragment (isolated from the Neor gene) into the NcoI site of the human c-fos gene. The primers used to amplify the c-fos fragment were 5h AGCCCGCTCCGTGCCAGACA 3h and 5h GTGGGCAGCTGCACAGCTGG 3h. A 210 bp fragment from c-fos and a 506 bp fragment from the competitive template were produced with these primers. The competitive template for c-jun was generated by insertion of a 246 bp heterologous DNA fragment (isolated from the IE1 gene) into the BstXI site of the human c-jun gene. The primers used to amplify the c-jun fragment were 5h AGATGCCCGGCGAGACACCG 3h and 5h AGCCCCCGACGGTCTCTCTT 3h. A 314 bp fragment from c-jun and a 560 bp fragment from the competitive template were produced with these primers. The primers used for β-actin were 5h GCCGAGCGGGAAATCGTGCG 3h and 5h ACGATGGAGGGGCCGGACTC 3h, which amplified a 500 bp fragment. The c-fos gene was kindly provided by M. Yoshida (Institute of Medical Science, University of Tokyo, Japan), and the c-jun gene by T. Deng (University of Florida, Gainesville, USA).
Results IE1 activates transcription from a promoter containing AP-1-binding sites
To test whether IE1 activates AP-1, we transfected cells with an AP-1 reporter plasmid (AP-1 CAT) containing a CAT
AP-1 activation by HCMV IE1 (a)
(b)
Fig. 1. Effects of IE1 on cellular transcription factors AP-1, Sp1 and Egr-1. (a) Reporter plasmids. The AP-1 reporter plasmid (AP-1 CAT) contains a bacterial CAT gene under the control of a truncated c-fos promoter and five consensus AP-1-binding sites. The truncated c-fos promoter (∆56) contains 56 bp upstream of the RNA start site, and the TATA box is its only transcriptional element. The Sp1 reporter plasmid (tk CAT9) contains two copies of a synthetic oligonucleotide derived from GC boxes III and IV of the SV40 early promoter, approximately 50 bp upstream of the transcriptional start site of a truncated HSV tk promoter (k37tk CAT). The Egr-1 reporter plasmid (PDGF-A CAT) was constructed by fusing a PDGF-A promoter to a CAT gene. (b) IE1 activates AP-1-driven transcription. U373MG or U937 cells were transfected with 3 µg of the various reporter plasmids, together with 3 µg of the IE1 expression plasmid pRSV-IE1 or the control plasmid pRc/RSV, by using the DEAE–dextran method. For CAT assays, 100 µg protein was incubated with [14C]chloramphenicol for 1 h at 37 mC. The results shown here are the means of five independent transfection assays.
Fig. 2. Effect of mutant IE1s on AP-1. U937 cells were transfected with 3 µg AP-1 reporter plasmid and 3 µg IE1 deletion expression plasmids. CAT assays were performed as described in Fig. 1. The results are the means of three independent transfection assays.
gene fused to a promoter with AP-1-binding sites upstream of a truncated c-fos promoter (Fig. 1 a). Transient expression of the CAT enzyme was used to measure the inducibility of AP1 by IE1. As controls, we also measured the inducibility of Sp1 and Egr-1 by using similar reporter plasmids containing binding sites for these transcription factors (Courey et al., 1989 ; Khachigian et al., 1995). These reporter plasmids were
transfected into the human microglial cell line U373MG and the human promonocytic cell line U937, together with the IE1 expression plasmid pRSV-IE1. When various reporter plasmids were co-transfected with pRc\RSV (lacking IE1), the levels of CAT activity were very low. However, co-transfection with pRSV-IE1 resulted in a large increase in CAT activity from the AP-1 reporter plasmid, while it had no significant effect on CAT expression from a control promoter lacking the AP-1binding sites (Fig. 1 b). As a further control, we used pRc\RSV containing the IE1 sequence in the antisense orientation. This plasmid had no effect on CAT expression driven by any of the promoters described above (data not shown). These data indicated that IE1 could activate transcription from promoters containing AP-1-, but not Sp1- or Egr-1-binding sites. We also tested the effect of previously characterized IE1 mutants (Lafemina et al., 1989) on activation of AP-1. Plasmids expressing mutant IE1 were transfected to U937 cells together with the AP-1 reporter plasmid. Results of AP-1 activation were compared between wild-type and mutant IE1s. No mutant IE1s induced AP-1-dependent transcription (Fig. 2). This result is consistent with previous reports suggesting that domains responsible for transcriptional activation are spread over the IE1 protein (Lafemina et al., 1989 ; Stenberg et al., 1990). In order to perform more quantitative analyses, we constructed cell lines stably expressing IE1. U373MG cells and U937 cells were transduced by a retroviral vector, LNC-gIE1, containing the IE1 gene. The parental vector lacking the IE1 sequence, LNCX, was used as a negative control. Following selection in G418, drug-resistant cells were subcloned and more than 12 subclones were derived from each of the U937 JGD
S. Kim and others (a)
(b)
Fig. 3. (a) Expression of IE1 proteins in U937 IE1 subclones. Whole-cell extracts were subjected to 8 % SDS–PAGE and electroblotted onto PVDF membrane (Gelman). Immunoblotting was performed with an anti-IE1 monoclonal antibody against exon 2 and 3 (MAB810 ; Chemicon). The blot was visualized by chemiluminescence by using peroxidase-labelled anti-mouse antibody (Amersham). Lane 1, LNCX cells ; 2, IE1-2 cells ; 3, IE1-3 cells. (b) AP-1-driven transcription is increased in U373MG and U937 cells expressing IE1 constitutively. Two µg reporter plasmid was transfected into IE1 or LNCX cells and 20 µg protein was analysed. The means of five independent assays are presented.
(a) c-fos
(b) c-jun
(c) β-actin
Fig. 4. Quantitative analysis of mRNA expression of AP-1 subunits in cells expressing IE1 and control cells. Competitor DNAs have binding sites for the PCR primers but contain additional sequences, so that larger-sized products were produced. For U937 cells, PCR template was cDNA from : LNCX cells (k, lanes 1, 5, 9) ; IE1-2 cells (j, lanes 2, 6, 10) ; IE1-3 cells (j, lanes 3, 7, 11) ; and PMA-treated LNCX cells (P, lanes 4, 8, 12). For U373MG cells, PCR template was cDNA from : LNCX-2 cells (k, lanes 1, 5, 9) ; IE1-1 cells (j, lanes 2, 6, 10) ; IE1-2 cells (j, lanes 3, 7, 11) ; and PMA-treated LNCX-2 cells (P, lanes 4, 8, 12). The result shown here is representative of more than five independent assays.
JGE
AP-1 activation by HCMV IE1
IE1 does not have a significant effect on the levels of c-fos and c-jun mRNA
To test whether the increase in AP-1 activity induced by IE1 was due to overexpression of AP-1 components, we compared the amounts of mRNA for c-fos and c-jun in various IE1-expressing subclones. Because the levels of c-fos and c-jun mRNA were too low to be detected by conventional Northern blot hybridization analysis, a quantitative RT–PCR method was used. Total RNAs were prepared from two IE1-expressing subclones and one control subclone from both U373MG and U937 cells, followed by RT–PCR. For quantitative analysis, serially diluted competitors of c-fos and c-jun were added to the fixed amount of cDNA in the PCR reaction. As a control, βactin RNA was also amplified. When the control cells were treated with PMA, levels of c-fos and c-jun mRNA were significantly increased (Fig. 4 a, b ; compare lane 5 with lane 8). However, the ratio of target to competitor products was reproducibly identical for a given amount of competitor between IE1-expressing and control cells (Fig. 4 a, b ; for example, compare lane 5 with lanes 6 and 7). The same experiments were performed with several other subclones and similar results were obtained (data not shown). These results indicated that the levels of c-fos and c-jun mRNA were not changed by expression of IE1 and that IE1 might regulate AP1 at the post-transcriptional level. Protein kinase inhibitors suppress IE1 activation of AP-1 in a cell type-dependent manner
Some mitotic stimuli, such as phorbol esters and growth factors, activate AP-1 through the protein kinase C (PKC) pathway, while other reagents, such as transforming growth factor (TGF) and cyclic AMP, seem to control AP-1 independently of PKC (Muller et al., 1989).
1.5
Relative CAT activity
Relative CAT activity
U373MG U937
1.0
0.5
1.5
1.0 0.5
2 4 6 8 10 12 GF109203X (µM)
20 40 60 80 100 120 Staurosporine (nM) 1.5
Relative CAT activity
Relative CAT activity
and U373MG populations. The expression of IE1 in the subclones was confirmed by Western blot analysis with a monoclonal antibody specific for an epitope present in exons 2 and 3 of IE1. More than six subclones from each cell line were found to express IE1. Two representative subclones derived from U937, IE1-2 and IE1-3, expressed a protein of approximately 72 kDa, which was not present in the control cell line U937 LNCX (Fig. 3 a), and were used in subsequent analysis. Both IE1-expressing and control cells (U373MG and U937 cells) were transfected with the AP-1, Sp1 and Egr-1 reporter plasmids. Transfection of these reporter plasmids alone or their respective control plasmids resulted in very low levels of CAT activity in cells lacking the IE1 protein. However, transfection of the AP-1 reporter plasmid into cells expressing IE1 always resulted in a dramatic increase in CAT activity (Fig. 3 b). Again, IE1 had no significant effect on CAT expression from the Sp1 or Egr-1 reporter plasmids. These results confirmed that IE1 could induce AP-1-driven transcription.
1.0
0.5
20 40 60 80 100 120 HA1004 (µM)
1.5
1.0 0.5
10
20 30 H7 (µM)
40
Fig. 5. Effect of protein kinase inhibitors on induction of AP-1 by IE1. Inhibition of protein kinase activity was performed with GF109203X, staurosporine, HA1004 and H7. GF109203X (10 mM) and staurosporine (100 µM) were dissolved in DMSO and HA1004 (10 mM) and H7 (10 mM) were dissolved in water. Cells expressing IE1 were transfected with 2 µg AP-1 reporter plasmid and 6 h later were treated with protein kinase inhibitors at the concentrations indicated. Cells were harvested 48 h after transfection and CAT assays were performed with 20 µg protein. The results shown here are the means of three independent experiments.
To investigate the involvement of protein kinases in the IE1 activation of AP-1, we tested the effects of various protein kinase inhibitors. Several IE1-expressing subclones were transfected with the AP-1 reporter plasmid and were treated with the PKC-specific inhibitor GF109203X (bisindolylmaleimide I) (Toullec et al., 1991), the general protein kinase inhibitor staurosporine (Tamaoki et al., 1986), the protein kinase A (PKA) inhibitor HA1004 [N-(2-guanidinoethyl)-5-isoquinolinesulfonamide] (Asano & Hidaka, 1984) and the PKC and PKA inhibitor H7 [1-(5-isoquinolinesulfonyl)-2-methylpiperazine] (Hidaka et al., 1984). The results from one representative subclone from U373MG and U937 cells expressing IE1 are shown in Fig. 5. In U373MG cells expressing IE1, AP-1 activity was blocked efficiently by 10 nM staurosporine but not by GF109203X, HA1004 or H7 (Fig. 5). In contrast, in U937 cells expressing IE1, staurosporine did not have any effect, even at a high concentration, while 5 µM H7 blocked AP-1 activation almost completely. These results suggested that a protein kinase(s) other than PKC and PKA might be involved in AP-1 activation by IE1, and that the mechanism by which IE1 activates AP-1 might differ between the two cell types. JGF
S. Kim and others (a)
(b)
Fig. 6. Effects of Ras, MEKK1, MKK4 and JNK1 on AP-1 activation by IE1. (a) U937 LNCX and IE1 cells were transfected with 0n5 µg AP-1 reporter plasmid together with 8 µg either control vector (pSRα-puro) or expression vectors for Ras (pSRα-Raspuro), MEKK1 (pSRα-MEKK1-puro), MKK4 (pSRα-MKK4-puro) or JNK1 (pSRα-JNK1-puro). (b) As a control, the same experiment was performed with the Egr-1 reporter plasmid. The results shown here are the means of five independent transfection assays.
MEKK1 has a highly synergistic effect on AP-1 activation by IE1
AP-1 activity can be modulated through phosphorylation. It is well established that some of the mammalian mitogenactivated protein kinase (MAPK) pathways regulate AP-1 activity (Cano & Mahadevan, 1995 ; Karin, 1995). The [Raf-1 MAPK\extracellular signal-regulated kinase kinase1 (MEK1) extracellular signal-regulated kinase 1, 2 (ERK 1, 2)] pathway induces c-Fos by activating the c-fos promoter through a serum response element (SRE), while the [MEKK1 MAPK kinase 4 (MKK4) c-Jun N-terminal kinase (JNK)] pathway activates c-Jun by phosphorylating c-Jun at its N terminus. Based on the above results from quantitative RT–PCR and protein kinase inhibitor assays, we tested the possible involvement of the [MEKK1 MKK4 JNK] pathway in the IE1 activation of AP-1. U937 IE1 cells and LNCX cells were transfected with plasmids expressing Ras, MEKK1, MKK4 or JNK1, together with the AP-1 reporter plasmid. Co-transfection of an expression vector for MKK4 or JNK1 appeared to have little effect on AP-1 activation by IE1, while Ras increased the level of CAT activity by an average of 2-fold. Cotransfection of an MEKK1 expression vector had a reproducible dramatic effect, resulting in an average 10-fold increase in the level of CAT activity (Fig. 6 a). This increase by MEKK1 occurred in a dose-dependent manner (data not shown). To be certain that this observation was specific for IE1, we performed a similar experiment with the Egr-1 reporter plasmid (PDGF-A CAT). IE1 did not increase transcription from this promoter, and none of the above expression vectors had any positive effect on the level of CAT activity (Fig. 6 b). To identify the regions of MEKK1 responsible for IE1 activation of AP-1, we used two previously characterized mutants, KMMEKK, containing a point mutation (K432M) in the catalytic domain and MEKK∆N, lacking the entire JGG
Fig. 7. Effect of mutant MEKK1s on AP-1 activation by IE1. U937 IE1 cells and LNCX cells were transfected with 0n5 µg AP-1 reporter plasmid together with 8 µg control vector (pSRα-puro) or expression vectors for a dominant-negative mutant of MEKK1 (pSRα-KMMEKK-puro), a truncated MEKK (pSRα-MEKK∆N-puro) or MEKK1 (pSRα-MEKK1-puro). Twenty µg protein was used in the CAT reaction. The result shown here is the mean of five independent transfection assays.
regulatory domain (Minden et al., 1994). As shown in Fig. 7, KMMEKK had no significant effect on AP-1 activation by IE1, while MEKK∆N could act synergistically with IE1 to a slightly greater degree than parental MEKK1. This result indicated that the kinase domain was sufficient for the synergistic effect of MEKK1 on AP-1 activation by IE1.
Discussion We have demonstrated that the IE1 protein of HCMV activates transcription efficiently from a promoter containing AP-1-binding sites, and that this activation does not occur at
AP-1 activation by HCMV IE1
the transcriptional level. Although transcription was increased from the AP-1 reporter plasmid in transfection assays, we found by electrophoretic mobility shift assay that AP-1 DNAbinding activity was not increased by IE1 expression (data not shown). Based on the results from experiments with protein kinase inhibitors, we suggest that IE1 activates AP-1 probably through modulation of a protein kinase(s), but different protein kinases may be involved in different cell types. Our data suggest that MEKK1 may be a key factor in this process. One possible mechanism for IE1 activation of AP-1 is that IE1 interacts directly with c-Fos or c-Jun and thereby modulates AP-1 activity. By various techniques, we tested whether IE1 binds to c-Fos or c-Jun, but failed to find direct association between the two proteins (data not shown). We propose two possible mechanisms involving protein kinase(s) in AP-1 activation by IE1. Firstly, IE1 itself may require phosphorylation by a protein kinase(s) for its function. Although IE1 has been shown to be a nuclear phosphoprotein, it is not yet clear whether phosphorylation is essential for its function. Because MEKK1 has recently also been shown to be present in the nucleus (Fanger et al., 1997), it may phosphorylate IE1 in the nucleus. Alternatively, a protein kinase(s) regulated by MEKK1 could phosphorylate IE1. Secondly, IE1 may control a protein kinase(s) that regulates cJun or c-Fos, resulting in activation of AP-1. Because the IE1 protein is present in the nucleus as well as in the cytosol (Otto et al., 1988), it is possible that IE1 may activate a cytosolic protein kinase(s) or a nuclear protein kinase(s). IE1 is known to have a kinase activity and this activity is required for transcription (Pajovic et al., 1997). Therefore, IE1 might regulate a cellular kinase(s) by phosphorylating it. We are currently testing these possibilities. It is well established that AP-1 activity can be regulated at both the transcriptional and the post-transcriptional levels (Angel & Karin, 1991 ; Angel & Herrlich, 1994 ; Karin, 1995). Several viral proteins, such as hepatitis B virus pX, Epstein–Barr virus latent membrane protein-1 and polyoma virus middlesized tumour antigen, have been shown to activate AP-1 (Scho$ nthal et al., 1992 ; Benn et al., 1996 ; Kieser et al., 1997). However, the underlying mechanism appears to be different depending on the activation protein. Polyoma virus middlesized tumour antigen activates AP-1 by increasing c-jun expression, Epstein–Barr virus latent membrane protein-1 upregulates AP-1 via the JNK cascade and hepatitis B virus pX induces AP-1 activity by increasing the level of c-fos mRNA and by stimulating protein kinases. Our data show that IE1 may employ an additional method of controlling AP-1. Therefore, all these DNA viruses have evolved to regulate AP1, probably for their own benefit. Indeed, these DNA viruses can grow much more efficiently when the host cell is in an ‘ activated ’ state, in which AP-1 is critically involved. AP-1 is a pleiotropic transcription factor that regulates many important genes involved in the immune response, cell differentiation and tumorigenesis. Induction of this factor by
the IE1 protein may lead to the activation of cellular genes important for HCMV itself, and also cause the activation of other viruses residing in the same cells, such as human immunodeficiency virus (HIV). Indeed, a direct effect of HCMV superinfection on HIV-1 replication has been demonstrated (Ho et al., 1990). Furthermore, increased activity of AP-1 may disrupt normal cellular functions and lead eventually to uncontrolled cell growth, inflammation and tumorigenesis. Because HCMV is prevalent in the human population and we have shown IE1 to be a potent activator of the important cellular transcription factor AP-1, it is important to understand more about how IE1 expression activates AP-1 at the molecular level, and to identify the putative protein kinase(s) that is involved. We thank Mitsuaki Yoshida, Gary S. Hayward, Roger J. Davis, Kentaro Semba and Tiliang Deng for providing us with plasmids. This work was supported in part by grants from the Korea Science and Engineering Foundations (96-0403-03-01-3 ; S. K.) and the Korea Ministry of Science and Technology (G7 Project 08-02-02 ; S. K.).
References Angel, P. & Karin, M. (1991). The role of Jun, Fos and the AP-1 complex
in cell-proliferation and transformation. Biochimica et Biophysica Acta 1072, 129–157. Angel, P. & Herrlich, P. A. (editors) (1994). The FOS and JUN Families of Transcription Factors. Boca Raton : CRC Press. Asano, T. & Hidaka, H. (1984). Vasodilatory action of HA1004 [N-(2guanidinoethyl)-5-isoquinolinesulfonamide], a novel calcium antagonist with no effect on cardiac function. Journal of Pharmacology and Experimental Therapeutics 231, 141–145. Benn, J., Su, F., Doria, M. & Schneider, R. J. (1996). Hepatitis B virus HBx protein induces transcription factor AP-1 by activation of extracellular signal-regulated and c-Jun N-terminal mitogen-activated protein kinases. Journal of Virology 70, 4978–4985. Biegalke, B. J. & Geballe, A. P. (1991). Sequence requirements for activation of the HIV-1 LTR by human cytomegalovirus. Virology 183, 381–385. Boldogh, I., AbuBakar, S. & Albrecht, T. (1990). Activation of protooncogenes : an immediate early event in human cytomegalovirus infection. Science 247, 561–564. Boldogh, I., AbuBakar, S., Deng, C. Z. & Albrecht, T. (1991).
Transcriptional activation of cellular oncogenes fos, jun, and myc by human cytomegalovirus. Journal of Virology 65, 1568–1571. Boldogh, I., Fons, M. P. & Albrecht, T. (1993). Increased levels of sequence-specific DNA-binding proteins in human cytomegalovirusinfected cells. Biochemical and Biophysical Research Communications 197, 1505–1510. Cano, E. & Mahadevan, L. C. (1995). Parallel signal processing among mammalian MAPKs. Trends in Biochemical Sciences 20, 117–122. Cherrington, J. M. & Mocarski, E. S. (1989). Human cytomegalovirus ie1 transactivates the α promoter-enhancer via an 18-base-pair repeat element. Journal of Virology 63, 1435–1440. Courey, A. J., Holtzman, D. A., Jackson, S. P. & Tjian, R. (1989).
Synergistic activation by the glutamine-rich domains of human transcription factor Sp1. Cell 59, 827–836. JGH
S. Kim and others Davis, M. G., Kenney, S. C., Kamine, J., Pagano, J. S. & Huang, E.-S. (1987). Immediate-early gene region of human cytomegalovirus trans-
Margolis, M. J., Pajovic, S., Wong, E. L., Wade, M., Jupp, R., Nelson, J. A. & Azizkhan, J. C. (1995). Interaction of the 72-kilodalton human
activates the promoter of human immunodeficiency virus. Proceedings of the National Academy of Sciences, USA 84, 8642–8646.
cytomegalovirus IE1 gene product with E2F1 coincides with E2Fdependent activation of dihydrofolate reductase transcription. Journal of Virology 69, 7759–7767.
De! rijard, B., Raingeaud, J., Barrett, T., Wu, I. H., Han, J., Ulevitch, R. J. & Davis, R. J. (1995). Independent human MAP-kinase signal
transduction pathways defined by MEK and MKK isoforms. Science 267, 682–685. Fanger, G. R., Johnson, N. L. & Johnson, G. L. (1997). MEK kinases are regulated by EGF and selectively interact with Rac\Cdc42. EMBO Journal 16, 4961–4972. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Molecular and Cellular Biology 2, 1044–1051. Grosschedl, R. & Baltimore, D. (1985). Cell-type specificity of immunoglobulin gene expression is regulated by at least three DNA sequence elements. Cell 41, 885–897. Hagemeier, C., Walker, S. M., Sissons, P. J. G. & Sinclair, J. H. (1992).
The 72K IE1 and 80K IE2 proteins of human cytomegalovirus independently trans-activate the c-fos, c-myc and hsp70 promoters via basal promoter elements. Journal of General Virology 73, 2385–2393. Hayhurst, G. P., Bryant, L. A., Caswell, R. C., Walker, S. M. & Sinclair, J. H. (1995). CCAAT box-dependent activation of the TATA-less
human DNA polymerase α promoter by the human cytomegalovirus 72kilodalton major immediate-early protein. Journal of Virology 69, 182–188. Hidaka, H., Inagaki, M., Kawamoto, S. & Sasari, Y. (1984). Isoquinolinesulfonamides, novel and potent inhibitors of cyclic nucleotide dependent protein kinase and protein kinase C. Biochemistry 23, 5036–5041. Hirano, M., Osada, S., Aoki, T., Hirai, S., Hosaka, M., Inoue, J. & Ohno, S. (1996). MEK kinase is involved in tumor necrosis factor α-induced
Michelson, S., Alcami, J., Kim, S. J., Danielpour, D., Bachelerie, F., Picard, L., Bessia, C., Paya, C. & Virelizier, J. L. (1994). Human
cytomegalovirus infection induces transcription and secretion of transforming growth factor β1. Journal of Virology 68, 5730–5737. Miller, A. D., Miller, D. G., Garcia, J. V. & Lynch, C. M. (1993). Use of retroviral vectors for gene transfer and expression. Methods in Enzymology 217, 581–599. Minden, A., Lin, A., McMahon, M., Lange-Carter, C., De! rijard, B., Davis, R. J., Johnson, G. L. & Karin, M. (1994). Different activation of ERK and
JNK mitogen-activated protein kinases by Raf-1 and MEKK. Science 266, 1719–1723. Mocarski, E. S., Jr (1996). Cytomegaloviruses and their replication. In Fields Virology, 3rd edn, pp. 2447–2492. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia : Lippincott–Raven. Monick, M. M., Geist, L. J., Stinski, M. F. & Hunninghake, G. W. (1992).
The immediate early genes of human cytomegalovirus upregulate expression of the cellular genes myc and fos. American Journal of Respiratory Cell and Molecular Biology 7, 251–256. Muller, U., Roberts, M. P., Engel, D. A., Doerfler, W. & Shenk, T. (1989). Induction of transcription factor AP-1 by adenovirus E1A
protein and cAMP. Genes and Development 3, 1991–2002. Otto, S. M., Sullivan-Tailyour, G., Malone, C. L. & Stinski, M. F. (1988).
Subcellular localization of the major immediate early protein (IE1) of human cytomegalovirus at early times after infection. Virology 162, 478–482. Pajovic, S., Wong, E. L., Black, A. R. & Azizkhan, J. L. (1997).
Ho, W.-Z., Harouse, J. M., Rando, R. F., Go$ nczo$ l, E., Srinivasan, A. & Plotkin, S. A. (1990). Reciprocal enhancement of gene expression and
Identification of a viral kinase that phosphorylates specific E2Fs and pocket proteins. Molecular and Cellular Biology 17, 6459–6464. Robbins, P. D., Horowitz, J. M. & Mulligan, R. C. (1990). Negative regulation of human c-fos expression by the retinoblastoma gene product. Nature 346, 668–671.
viral replication between human cytomegalovirus and human immunodeficiency virus type 1. Journal of General Virology 71, 97–103.
Sambucetti, L. C., Cherrington, J. M., Wilkinson, G. W. & Mocarski, E. S. (1989). NF-κB activation of the cytomegalovirus enhancer is
Ikeuchi, K., Kim, S., Byrn, R. A., Goldring, S. R. & Groopman, J. E. (1990). Infection of nonlymphoid cells by human immunodeficiency
mediated by a viral transactivator and by T cell stimulation. EMBO Journal 8, 4251–4258. Scho$ nthal, A., Srinivas, S. & Eckhart, W. (1992). Induction of c-jun protooncogene expression and transcription factor AP-1 activity by the polyoma virus middle-sized tumor antigen. Proceedings of the National Academy of Sciences, USA 89, 4972–4976. Scully, A. L., Sommer, M. H., Schwartz, R. & Spector, D. H. (1995). The human cytomegalovirus IE2 86-kilodalton protein interacts with an early gene promoter via site-specific DNA binding and protein–protein associations. Journal of Virology 69, 6533–6540.
NF-κB activation and degradation of IκB-α. Journal of Biological Chemistry 271, 13234–13238.
virus type 1 or type 2. Journal of Virology 64, 4226–4231. Karin, M. (1995). The regulation of AP-1 activity by mitogen-activated protein kinases. Journal of Biological Chemistry 270, 16483–16486. Khachigian, L. M., Williams, A. J. & Collins, T. (1995). Interplay of Sp1 and Egr-1 in the proximal platelet-derived growth factor A-chain promoter in cultured vascular endothelial cells. Journal of Biological Chemistry 270, 27679–27686. Kieser, A., Kilger, E., Gires, O., Ueffing, M., Kolch, W. & Hammerschmidt, W. (1997). Epstein–Barr virus latent membrane
protein-1 triggers AP-1 activity via the c-Jun N-terminal kinase cascade. EMBO Journal 16, 6478–6485. Kim, S., Yu, S. S. & Kim, V. N. (1996). Essential role of NF-κB in transactivation of the human immunodeficiency virus long terminal repeat by the human cytomegalovirus IE1 protein. Journal of General Virology 77, 83–91. Lafemina, R. L., Pizzorno, M. C., Mosca, J. D. & Hayward, G. S. (1989).
Expression of the acidic nuclear immediate-early protein (IE1) of human cytomegalovirus in stable cell lines and its preferential association with metaphase chromosomes. Virology 172, 584–600. JGI
Soneoka, Y., Cannon, P. M., Ramsdale, E. E., Griffiths, J. C., Romano, G., Kingsman, S. M. & Kingsman, A. J. (1995). A transient three-
plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Research 23, 628–633. Stenberg, R. M., Fortney, J., Barlow, S. W., Magrane, B. P., Nelson, J. A. & Ghazal, P. (1990). Promoter-specific trans activation and
repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains. Journal of Virology 64, 1556–1565. Stinski, M. F., Thomsen, D. R., Stenberg, R. M. & Goldstein, L. C. (1983). Organization and expression of the immediate early genes of
human cytomegalovirus. Journal of Virology 46, 1–14.
AP-1 activation by HCMV IE1 Tamaoki, T., Nomoto, H., Takahashi, I., Kato, Y., Morimoto, M. & Tomita, F. (1986). Staurosporine, a potent inhibitor of phospholipid\
Ca++ dependent protein kinase. Biochemical and Biophysical Research Communications 135, 397–402. Tevethia, M. J., Spector, D. J., Leisure, K. M. & Stinski, M. F. (1987).
Participation of two human cytomegalovirus immediate early gene regions in transcriptional activation of adenovirus promoters. Virology 161, 276–285. Toullec, D., Pianetti, P., Coste, H., Bellevergue, P., Grand-Perret, T., Ajakane, M., Baudet, V., Boissin, P., Boursier, E., Loriolle, F. and
others (1991). The bisindolylmaleimide GF 109203X is a potent and
selective inhibitor of protein kinase C. Journal of Biological Chemistry 266, 15771–15781. Yurochko, A. D., Kowalik, T. F., Huong, S. M. & Huang, E. S. (1995).
Human cytomegalovirus upregulates NF-κB activity by transactivating the NF-κB p105\p50 and p65 promoters. Journal of Virology 69, 5391–5400.
Received 26 August 1998 ; Accepted 12 November 1998
JGJ
