Ala160 and His116 residues are involved in ... - Semantic Scholar
Microbiology (2005), 151, 2853–2860
DOI 10.1099/mic.0.28142-0
Ala160 and His116 residues are involved in activity and specificity of apyrase, an ATP-hydrolysing enzyme produced by enteroinvasive Escherichia coli Serena Sarli,1 Mauro Nicoletti,2 Serena Schippa,1 Federica Del Chierico,1 Daniela Santapaola,2 Piera Valenti3 and Francesca Berlutti1 1
Dipartimento di Scienze di Sanita` Pubblica, Universita` di Roma ‘La Sapienza’, Piazzale A. Moro, 5 00185 Rome, Italy
Correspondence Francesca Berlutti [email protected]
2
Dipartimento di Scienze Biomediche, Sezione di Microbiologia, Universita` G. D’Annunzio, Chieti, Italy
3
Dipartimento di Medicina Sperimentale, Seconda Universita`, Naples, Italy
Received 21 April 2005 Revised 22 June 2005 Accepted 23 June 2005
The virulence plasmid-carried apy (phoN2) gene of Shigella and related enteroinvasive Escherichia coli (EIEC) encodes apyrase, an ATP-diphosphohydrolase belonging to class A of the non-specific acid phosphatases (A-NSAPs). Apyrase and A-NSAPs share three domains of conserved amino acids (domains D1–D3) containing residues forming the putative active site of apyrase. In spite of their similarity, apyrase and A-NSAPs show different substrate specificity, apyrase being able to hydrolyse nucleotide tri- and diphosphates, but not monophosphates, as well as p-nitrophenyl phosphate (pNPP), while A-NSAPs are also active towards monophosphates and pNPP. In this paper, to get further insights into the structure–function relationship of apyrase, a random and site-directed mutagenesis of the apy gene of EIEC strain HN280 was conducted. Results indicate that amino acids located within the D2 and D3 conserved domains (Ser157 and Arg192, respectively) as well as residues located in the N-terminal (Ser97) and C-terminal (Glu233) domains are required for enzyme activity. Surprisingly, Ala160, located near the D2 domain and considered to be important for enzyme specificity, is required for enzyme activity, as its substitution with Thr led to the inactivation of enzyme activity. Furthermore, residue His116 is involved in apyrase specificity, since the H116L apyrase mutant shows substrate specificity resembling that of A-NSAPs.
INTRODUCTION Apyrases are ATP-diphosphohydrolase enzymes (EC 3.6.1.5) commonly found in eukaryotic cells, where they play an important role in the control of cellular nucleotide levels (Komoszynki & Wojtczak, 1996). In prokaryotes, apyrases have so far been found only in Shigella and related enteroinvasive Escherichia coli (EIEC) strains, and in the thermoacidophilic archaeon Sulfolobus acidocaldarius (Amano et al., 1993; Berlutti et al., 1998; Bhargava et al., 1995). Apyrase of EIEC and of Shigella flexneri is encoded by the virulence plasmid (pINV)-encoded apy (phoN2) gene (Buchrieser et al., 2000; Venkatesan et al.; 2001; Santapaola Abbreviations: EIEC, enteroinvasive Escherichia coli; NSAPs, nonspecific acid phosphatases; A-NSAPs, class A of non-specific acid phosphatases; pNPP, p-nitrophenyl phosphate; PDP, phenolphthalein diphosphate tetrasodium salt.
0002-8142 G 2005 SGM
Printed in Great Britain
et al., 2002), whose sequence is highly conserved in both species (the apyrase of EIEC strain HN280 differs in primary amino acid sequence from that of S. flexneri strain M90T only by one residue located at its N-terminus) (Santapaola et al., 2002; SWISS-PROT/TrEMBL accession numbers Q99QG5 and Q93IG8). Apyrase is a 27 kDa protein which utilizes the Sec machinery for its secretion across the inner membrane (Bhargava et al., 1995; Santapaola et al., 2002). Even though a specific role has not yet been assigned, apyrase has been considered as a pathogenesis-associated enzyme, possibly involved either in mitochondrial damage and host cell death, or in the Shigella- and EIEC-induced process of actin polymerization (Bhargava et al., 1995; Mantis et al., 1996; Berlutti et al., 1998; Santapaola et al., 2002). Because of its similarity, apyrase has been included in class A of the non-specific bacterial acid phosphatases (A-NSAPs) (EC 3.1.3.2), which also includes PhoN-Sf of S. flexneri, 2853
S. Sarli and others
PhoN of Salmonella enterica ser. Typhi, PhoC of Morganella morganii, PhoN of Providencia stuartii, PhoC of Zymomonas mobilis and EB-NSAP of Escherichia blattae (Rossolini et al., 1998; Ishikawa et al., 2000). In spite of its similarity, apyrase shows a substrate specificity distinct from that of A-NSAPs. While apyrase is able to sequentially hydrolyse nucleoside tri- and diphosphates to the corresponding diphosphates and monophosphates, but is not active against monophosphates, A-NSAPs are also able to hydrolyse monophosphates. Moreover, in contrast to A-NSAPs, apyrase is scarcely active towards p-nitrophenyl phosphate (pNPP) (Babu et al., 2002; Bhargava et al., 1995; Rossolini et al., 1998) and has an optimum pH of 7?5 (6?0–6?5 for ANSAPs) (Bhargava et al., 1995; Rossolini et al., 1998). Few data are presently available on the structure–function relationships of apyrase and A-NSAPs. Sequence alignment has identified three domains of conserved amino acids, namely the K(X6)RP domain (D1), the PSGH domain (D2) and the SR(X5)H(X3)D domain (D3) (Stukey & Carman, 1997; Mihara et al., 2000; Babu et al., 2002). Recently, the three-dimensional structure of EB-NSAP of E. blattae has been determined and its active site consists of eight residues contained within the three conserved (D1–D3) domains, namely the Lys and Arg residues within the D1 domain, the Ser, Gly and His residues within the D2 domain, and the Arg, His and Asp residues within the D3 domain (Ishikawa et al., 2000). Based on the high degree of similarity between EB-NSAP and apyrase (50 % overall identity and 73 % similarity), a putative three-dimensional structure of apyrase has been proposed and a putative active site, consisting of the above-mentioned eight residues, has been hypothesized (Babu et al., 2002). Interestingly, the residue next to His of the PSGH D2 domain is Thr in EB-NSAP as well as in all ANSAPs sequenced so far, while it is Ala (Ala160) in apyrase. As the His residue of the PSGH D2 domain of E. blattae has been reported to be involved in the formation of the phospho-intermediate (Ishikawa et al., 2000), it has been speculated that Ala160 of apyrase might be important in dictating apyrase substrate specificity (Babu et al., 2002). To get further insights into the structure–function relationship of apyrase, we have performed PCR-based random and site-directed mutagenesis of the apy gene of EIEC strain HN280 (Berlutti et al., 1998). Analysis of randomly generated mutants indicates that mutations (amino acid substitutions) leading to apyrase inactivation occur, as expected, within the D2 and D3 conserved domains (residues Ser157 and Arg192, respectively) as well as within residues not involved in the putative active site, such as Ser97 and Glu233, which are located within the N- and Ctermini of apyrase. Unexpectedly, our results indicate that Ala160 is also important for enzyme activity and not for substrate specificity, as its substitution with Thr leads to the inactivation of the enzyme. In contrast, His116 seems to be involved in apyrase specificity, as the H116L apyrase mutant is able to dephosphorylate monophosphates, though to a low extent. 2854
METHODS Bacterial strains, plasmids and culture conditions. The bacter-
ial strains and plasmids used are listed in Table 1. Growth media were Terrific broth (TB) and Luria broth (LB) medium supplemented with glucose (1 % final concentration) (Sambrook et al., 1989). The solid media contained 1?5 % agar. A modified Tryptose phosphate/phenolphthalein/methyl green (M-TPMG) agar medium was used to detect apyrase activity on plates (Thaller et al., 1998). MTPMG plates were made of Tryptose-phosphate agar (Difco) dissolved in 50 mM phosphate buffer (pH 7?2) supplemented with 1 % (final concentration) glucose, 2 mg phenolphthalein diphosphate tetrasodium salt (PDP) (Sigma) ml21 and 50 mg methyl green (Sigma) ml21. On these plates, apyrase-positive strains produce green colonies, whereas apyrase-negative strains produce white colonies. Antibiotics were used at the following concentrations: 100 mg ampicillin ml21; 30 mg kanamycin ml21. IPTG was used at 1 mM to induce expression of His6-tagged recombinant proteins. General DNA manipulations. All basic recombinant DNA proce-
dures, such as extraction of plasmid DNA, PCR, restriction enzyme digestion, ligation of DNA fragments, and transformation of E. coli, were performed as described by Sambrook et al. (1989). Construction and isolation of apyrase mutants. A 1032 bp
DNA fragment, containing the entire apy gene of EIEC strain HN280 (GenBank no. AJ315184), was PCR-amplified with proofreading Taq polymerase (New England BioLabs), using pHN99 plasmid as DNA template and the primer pair FB30 and FB31 (Table 2). The amplified DNA fragment was cloned into the SmaI site of pUC18, thus giving rise to plasmid pFB1 (Table 1). Random mutations were introduced throughout the apy-coding region carried by plasmid pFB1. Error-prone PCR was performed as previously described (Cadwell & Joyce, 1992, 1994), under conditions of low fidelity. Reaction mixtures contained 16 PCR buffer (New England BioLabs), 30 pmol each primer FB30 and FB31, 20 fmol template pFB1 plasmid DNA, 5 units Taq polymerase and 5 % glycerol, in a total volume of 50 ml. Samples were subjected to 30 cycles, each cycle comprising 1 min denaturation at 96 uC, 2 min primer annealing at 42 uC and 3 min extension with Taq polymerase at 72 uC. The resulting PCR fragments were digested with PvuII–XbaI and an 849 bp fragment encompassing the entire apy gene was recovered from a 1 % agarose gel and ligated between the EcoV and the XbaI sites of plasmid pBluescript SK (Stratagene). The ligation mixture was used to transform E. coli strain DH5a competent cells. Recombinant clones, containing PCR-generated apy mutants, were isolated on M-TPMG plates. To construct an apyrase mutant with the amino acid A160T substitution (amino acids are numbered according to SWISS-PROT/ TrEMBL entry Q93IG8), the FBA160TF and FBA160TR primers (Table 2) were designed in order to substitute nucleotide G with A in the GCA codon of Ala160. PCR experiments were carried out using plasmid pFB1 as template and an in vitro mutagenesis kit (QuickChange Site-Directed Mutagenesis kit, Stratagene), as recommended by the manufacturer. PCR was carried out with programmes of 16 cycles, each cycle comprising 45 s denaturation at 96 uC, 1 min primer annealing at 55 uC and 5 min extension with PfuUltra High Fidelity DNA Polymerase (New England BioLabs) at 68 uC. Amplified DNA fragments were digested with DpnI and 1 ml aliquots were ligated and the ligation mixture used to transform E. coli DH5a competent cells. Plasmid DNA preparations from independent transformants were assayed for an expected loss of an NsiI restriction site. Three independent positive clones were detected, and sequence analysis indicated that all three carried the expected Thr ACA codon instead of the Ala GCA codon. No other nucleotide change appeared within the apy-coding region of the three independent mutants. Microbiology 151
Structure–function relationship of apyrase of EIEC
Table 1. Bacterial strains and plasmids used in this study Strain/plasmid
Relevant characteristics
HN280 E. coli DH5a E. coli M15(pREP4) pBluescript SK pUC18 pQE30 pHN99 pFB1 pFB1-4, pFB1-16, pFB1-34, pFB1-83, pFB1-500, pFB1-700, pFB1-710, pFB1-821 pFB1-104, pFB1-127, pFB1-162 pFBQ-N pFBQ-500
Source/reference
Wild-type EIEC strain of serotype O135 : K2 : H2, contains pINV pHN280; apy+ F2 080dlacZDM15 D(lacZYA–argF)U169 deoR recA1 endA1 z hsdR17(r{ k m k ) phoA supE44 1- thi-1 gyrA96 relA1 Host for expression vector pQE30 carrying pREP4 (lacI q Kmr p14A ori), Kmr Cloning plasmid vector; Ampr Cloning plasmid vector; Ampr Expression plasmid vector; Ampr pACYC177-derived vector carrying the 8023 bp PstI apy-encoding DNA fragment of pHN280; apy+ pUC18-derived plasmid carrying the 1032 bp apy-encoding DNA fragment of pHN99; apy+ Independent pFB1-derived plasmids from random mutagenesis experiments Independent pFB1-derived plasmids containing the apyA160T substitution pQE30-derived plasmid carrying a 671 bp DNA fragment from pFB1 encoding wild-type apyrase pQE30-derived plasmid carrying a 671 bp DNA fragment from pFB1 encoding H116L mutant apyrase
Construction and purification of His6-tagged recombinant proteins. FBB and FBH primers (Table 1) were used to amplify the
apy gene from plasmids pFB1 and pFB1-500, which carried wildtype and apyH116L mutant genes, respectively (Table 2). The two PCR-generated fragments were digested with BamHI and HindIII and cloned separately between the BamHI and HindIII sites of the polylinker of plasmid pQE30 (Qiagen), thus generating plasmids pFBQ-N and pFBQ-500, respectively. Plasmid pFBQ-N carries the wild-type apy gene encoding mature wild-type enzyme, and pFBQ500 carries the apyH116L mutant gene encoding mature H116L mutant apyrase. Both fragments were cloned in-frame with the His6-coding sequence of pQE30 and recombinant plasmids were transformed separately into E. coli M15 (pREP4) (Table 1). Recombinant proteins carrying a His6-tag were purified using nickelnitrilotriacetic acid (Ni-NTA) agarose resin (Qiagen), according to the manufacturer’s protocol. Briefly, M15 (pREP4) bacteria harbouring either pFBQ-N or pFBQ-500 were grown in 500 ml LB at 37 uC until
Berlutti et al. (1998) Promega Qiagen Stratagene Inc., La Jolla, CA Yanisch-Perron et al. (1985) Qiagen Santapaola et al. (2002) This study This study
This study This study This study
the OD600 of the culture reached 0?8, and IPTG was added to a final concentration of 1 mM. After 2 h induction at 37 uC, bacteria were harvested by centrifugation and suspended in lysis buffer (50 mM Na2HPO4, 300 mM NaCl, 30 mM imidazole, pH 8) supplemented with 1 mg lysozyme ml21, incubated on ice for 30 min and sonicated eight times for 30 s in a Soniprep MSE 150 apparatus (Sanyo; frequency 23 kHz, amplitude 15 mm). Cleared lysates were prepared by centrifugation of the sonicated extracts at 15 000 g for 30 min at 4 uC, mixed with 2 ml Ni-NTA agarose resin and incubated for 2 h at 4 uC with gentle agitation. The resin was washed extensively with lysis buffer containing 50 mM imidazole and proteins bound to the resins were eluted with elution buffer (50 mM Na2HPO4, 300 mM NaCl, pH 8?0) containing increasing concentrations (70, 100, 150, 200 and 500 mM) of imidazole and collected in 500 ml fractions. Eluted proteins were analysed by SDS-PAGE, either stained with Coomassie brilliant blue, or transferred to PVDF membrane and probed with mouse polyclonal antibodies against apyrase or with mouse monoclonal antibodies against the His6-tag (Qiagen). The activity of the two
Table 2. Oligonucleotides used in this study Primer FB30 FB31 FBA160TF FBA160TR FBB FBH
Sequence* (5§–3§)
LocationD
CATCATAATACAGAGACAAAACG AGATCTATGCTCATATAGGGTAGATT TGGCTCTTATCCCTCTGGTCATACATCCTTTG CAAAGGATGTATGACCAGAGGGATAAGAGCCA GGGGGGATCCCTGAAGGCAGAAGGTTTT GGGGAAGCTTATGGGGTCAGTTCATTGGT
4716–4739 5729–5749 5403–5434 5403–5434 5017–5034 5668–5687
Features Used to construct pFB1 Used to construct pFB1-104, pFB1-127, pFB1-162 Used to construct pFBQ-N, pFBQ-500
*Restriction sites introduced at the 59 end of the oligonucleotides are underlined. DThe nucleotide numeration was based on GenBank entry no. AJ315184. http://mic.sgmjournals.org
2855
S. Sarli and others recombinant apyrases towards different substrates was determined after overnight dialysis against 5 mM Tris/HCl buffer (pH 7?0), as described below. Enzyme assays. The apyrase activity of crude cell extracts and of purified His6-tagged enzymes was assayed at 37 uC in 200 ml 0?1 M Tris/HCl (pH 7?5), 1 mM ATP and 10 mM EDTA, as described by Bhargava et al. (1995). The reaction was stopped by the addition of 1 : 10 volume of trichloroacetic acid and the phosphates released were estimated. Protein concentrations were determined by the method of Bradford (1976), using a commercial kit (Bio-Rad), with BSA as standard. Enzyme activity was also assayed using the set of different substrates shown in Table 3. Enzyme activity towards pNPP was assayed using a reaction mixture that contained 100 mM Tris/HCl (pH 7?5), 10 mM EDTA and 5 mM pNPP in a total volume of 300 ml. The reaction was stopped by the addition of 700 ml 2 M NaOH and the release of p-nitrophenol was monitored by the measurement of absorbance at 414 nm.
10 % (w/v) ascorbic acid. Apyrase activity was visualized by the appearance on the gels after 10 min incubation at room temperature of a blue precipitate located at a migration distance corresponding to the Mr of the polypeptide component of the renatured enzyme. When PDP was used as substrate, after renaturation the gels were equilibrated for 1 h in several changes of 100 mM sodium acetate buffer (pH 6?0). Enzyme activity was visualized by the addition of 4 mM PDP and 50 mM methyl green to the equilibration buffer and was indicated by the presence of green bands after overnight incubation at 37 uC. Western blot analysis. Whole bacterial extracts were prepared and separated by SDS-PAGE. Gels were either stained with Coomassie brilliant blue or transferred to PVDF membranes (Amersham) and subjected to Western blot analysis, using mouse anti-apyrase polyclonal (1 : 2500) or anti-His6-tag (1 : 7500) monoclonal antibodies (Qiagen). Horseradish peroxidase-labelled rabbit anti-mouse secondary antibodies were used as secondary antibodies and visualized by enhanced chemiluminescence. DNA sequencing and computer analysis. Nucleotide sequences
The optimum pH was assayed in 50 mM sodium acetate (pH range 4–6?5) or in 50 mM Tris/HCl (pH range 6?0–9?5), using 1 mM ATP as substrate. Kinetic constants for ATP and pNPP were determined under the assay conditions described above, and calculated by using a Lineweaver– Burk plot (Segel, 1975). The procedure for zymogram detection of phosphatase activity was performed as previously described (Berlutti et al., 1998; Thaller et al., 1995). Briefly, crude cell extracts were separated by 12?5 % SDS-PAGE. After electrophoresis, the gels were incubated 3 h at 37 uC in several changes of renaturation buffer [50 mM Tris/HCl (pH 7?0), 1 % (v/v) Triton X-100] to obtain apyrase renaturation. To evaluate ATPhydrolysing activity, after renaturation, the gels were equilibrated for 1 h in several changes of 100 mM Tris/HCl (pH 7?5) and incubated for 30 min at approximately 10 uC in 100 mM Tris/HCl (pH 7?5), 10 mM EDTA and 1 mM ATP. Enzyme activity was visualized by immersing the gels in a 4 : 1 (v/v) freshly prepared solution of acidified ammonium molybdate (5 mM ammonium molybdate, 0?12 M sulphuric acid) and
Table 3. Activity of purified His6-tagged wild-type and H116L mutant apyrase The values are relative to that of ATP, which is set as 100 %. Substrate
ATP 59-AMP 39-AMP ADP 59-UMP 39-UMP 39-GMP 59-GMP 39-CMP 59-CMP Glucose 1-phosphate Glucose 6-phosphate Ribose 5-phosphate pNPP
2856
Relative activity (%) Wild-type
H116L mutant
100±2 0?1±0?01 0?2±0?03 59?7±4?3 2?7±1?1 1?1±0?01 0?2±0?01 1?4±0?5 0?2±0?03 0?2±0?02 0?2±0?01 0?3±0?03 0?3±0?01 1?0±0?01
100±2?5 0?7±0?09 1?2±0?01 67?5±5?1 6?7±2?9 6?1±1?7 1?0±0?03 1?2±0?03 1?1±0?04 1?3±0?01 0?8±0?09 1?6±0?03 1?3±0?1 14?3±0?9
were determined on denatured double-stranded DNA templates using the dideoxy-chain-termination method (Sanger et al., 1977). The nucleotide sequence was determined for both strands. Sequence data were compared using the FASTA 3 algorithm (http://www.ebi. ac.uk/fasta33/) and the deduced amino acidic sequences were aligned using the CLUSTAL W program (http://www.ebi.ac.uk/clustalw/). Modelling of wild-type and apyrase mutant was obtained by threading using the Geno3D-model (http://geno3d-pbil.ibcp.fr/cgi-bin/ geno3d_automat.pl?page=/GENO3D/geno3d_home.html) with EBNSAP as PDB model (1D2T).
RESULTS Isolation of apy mutants by random mutagenesis A mutational analysis (random and site-directed) of the apy gene cloned from EIEC strain HN280 was conducted to investigate the structure–function relationship of apyrase. Plasmid pFB1 (Table 1) was used to introduce mutations into the apy gene by error-prone PCR and a pBluescript SK-based mutant library was constructed in E. coli DH5a, as described in Methods. M-TPMG plates were used in order to screen recombinant clones. On these plates, apyrase-producing DH5a (pFB1) (positive-control strain) forms green colonies after 24 h incubation at 37 uC while apyrase-negative strains DH5a, DH5a (pUC18) and DH5a (pBluescript SK) produce colourless colonies (negativecontrol strains). Out of more than 12 000 recombinant colonies examined, 40 were selected as colourless and six as hyper-green colonies on M-TPMG plates. Colourless and hyper-green colonies were taken for further investigation. Of these, 36 colourless and two hyper-green clones were not investigated further because they harboured plasmids presenting unexpected molecular rearrangements, or because they scored negative in Western blots conducted using anti-apyrase polyclonal antibodies. The apyrase activity of the remaining four colourless clones was assayed against ATP and pNPP, and by zymogram against ATP and PDP, as substrates. While the crude cell extract of E. coli DH5a (pFB1) was active on ATP (but not on pNPP) and contained a protein able to Microbiology 151
Structure–function relationship of apyrase of EIEC
dephosphorylate ATP (but not PDP) of the expected size of mature apyrase (zymogram analysis), cell extracts of the four colourless clones (DH5a carrying pFB1-4, pFB1-16, pFB1-34 or pFB1-83) did not show enzyme activity (Fig. 1). Western analysis indicated that all four colourless clones are able to synthesize a protein which is recognized by apyrasespecific antibodies (data not shown). DNA sequencing of the recombinant plasmids enabled detection of the mutations within the apy-coding region. pFB1-4, pFB1-34 and pFB1-16 carry single non-conservative amino acid substitutions (R192P, located within the D3 domain, S157P, located within the D2 domain, and E233G, located within the Cterminus region, respectively), while pFB1-83 presents a double substitution, a conservative one (I194V) within the D3 domain, and a non-conservative one (S97P) within the N-terminus (Fig. 1). Of the remaining four hyper-green apyrase mutants (DH5a carrying plasmids pFB1-500, pFB1-700, pFB1-710 or pFB1821), all show altered substrate specificity, since bacterial extracts hydrolysed both ATP and pNPP. Moreover, zymogram analysis identified a protein of the size of mature apyrase active towards both ATP and PDP (Fig. 1). Sequencing recognized an identical A to T substitution, which changes the CAT in a CTT codon, leading to the
substitution of His116 for Leu116. Taken together, these data strongly suggest that His116 might be important in dictating apyrase specificity. Specific activity and kinetic analysis of the H116L apyrase mutant To better characterize enzymic activity and substrate specificity of the H116L apyrase, recombinant plasmids pFBQ-N and pFBQ-500 were constructed (Table 1). His6-tagged recombinant wild-type and H116L mutant apyrase were purified to approximately 90 % homogeneity and were both recognized in Western blot experiments by antibodies directed against apyrase or against the His6-tag (data not shown). Purified His6-tagged wild-type and H116L apyrase mutant proteins show a pH optimum at 7?5. About 50 % of the enzyme activity is retained in the pH range 5–8?5. Next, enzyme activity was evaluated at pH 7?5 against different substrates. As shown in Table 3, wild-type and H116L mutant apyrase exhibit different substrate specificities. As expected, wild-type apyrase is able to dephosphorylate only ATP and ADP, while mutant apyrase exhibits a broad substrate activity, being able to dephosphorylate, even if at a low extent, various monophosphates. The more relevant
Fig. 1. Wild-type and recombinant apyrases, obtained by random and site-directed mutagenesis of the apy gene of the EIEC strain HN280. Amino acid numeration is based on the apyrase sequence of SWISS-PROT/TrEMBL accession number Q93IG8. Wild-type apyrase spans 246 residues. L (dotted area), leader sequence; D1, K(6X)RP conserved domain 1, 124–132 residues; D2, PSGH conserved domain 2, 156–159 residues; D3, SR(5X)H(3X)D conserved domain 3, 191–202 residues. ATP values are expressed as pmol Pi (mg protein)”1 min”1. pNPP values are expressed as pmol p-nitrophenol (mg protein)”1 min”1. http://mic.sgmjournals.org
2857
S. Sarli and others
Table 4. Kinetic parameters of purified His6-tagged wild-type and H116L mutant apyrase using ATP and pNPP as substrates Enzyme
Wild-type H116L mutant
ATP ”1
Km (mM)
kcat (s )
21±0?5 24±0?7
374±5 188±2
pNPP ”1
kcat/Km (M
1?861027 7?861026
”1
s )
Km (mM)
kcat (s”1)
kcat/Km (M”1 s”1)
15±1?9 3?5±0?8
12±0?2 42±0?7
861022 1?261024
difference between wild-type and H116L mutant apyrase is observed in the ability of the latter to dephosphorylate pNPP (about 14-fold increase), 39-UMP and 39-AMP (about sixfold increase), and glucose 6-phosphate (about fivefold increase).
analysis, both of which failed to find any hydrolysing activity (Fig. 1), while Western analysis revealed the presence of a protein of a molecular size corresponding to apyrase (data not shown). These data indicate that Ala160 is important for apyrase activity and not for specificity.
The steady-state kinetic parameters of wild-type and H116L mutant apyrase at pH 7?5 are reported in Table 4. Steadystate kinetic parameters have been also determined at pH 6?5 and 8?5 for ATP and pNPP. As far as ATP is concerned, whereas kcat values show a distinct maximum at pH 7?5 and decrease significantly at lower and higher pH values, Km values for both wild-type and H116L mutant apyrase decrease steadily over the range 6?5–8?5 (from 58 and 84 mM at pH 6?5 to 11 and 13 mM at pH 8?5, for His6tagged wild-type and H116L apyrase, respectively). As far as pNPP is concerned, the kcat values recorded for both His6tagged wild-type and H116L mutant apyrase show a distinct maximum at pH 7?5 and decrease significantly at lower and higher pH values, and the respective Km values demonstrate a distinct minimum value at pH 7?5 and increase significantly at lower and higher pH values (210 and >250 mM at pH 6?5 and 8?5, respectively, for wild-type apyrase, and 16 and 75 mM at pH 6?5 and 8?5, respectively, for H116L apyrase). At the optimum pH, the H116L mutation induces a moderate increase of the Km value for ATP and a significant decrease for pNPP. Moreover, the replacement of His116 with Leu increases the catalytic efficiency of the enzyme, as demonstrated by the kcat/Km ratio for pNPP.
Structural analysis of the A160T apyrase mutant
Site-directed mutagenesis It has been recently hypothesized that residue Ala160 next to His159 of the PSGH conserved D2 domain of apyrase might be involved in enzyme specificity, since in all ANSAPs sequenced so far the residue corresponding to Ala160 is invariably Thr (Mihara et al., 2000; Babu et al., 2002). To assess whether Ala160 plays any role in determining apyrase specificity, we substituted this residue with Thr by site-directed mutagenesis (as described in Methods). Three independent DH5a mutants, harbouring plasmids pFB1104, pFB1-127 or pFB1-162 (Fig. 1), were analysed, and the introduction of the correct nucleotide substitution was confirmed by DNA sequencing. Unexpectedly, all three mutants produce colourless colonies on M-TPMG plates, indicating that the A160T substitution might have induced apyrase inactivation. That this is the case was confirmed by the analysis of crude protein extracts and by zymogram 2858
The hypothetical three-dimensional structure of wild-type and A160T mutant apyrase was obtained by threading, using the Geno3D-model with EB-NSAP as PDB model (1D2T). The relative orientation of residues of the putative active site of wild-type apyrase was compared to that of A160T inactive apyrase (Fig. 2 a and b, respectively). The A160T mutant enzyme shows alterations of the spatial configuration of the putative active site, compared to that of wild-type apyrase. In particular, the distance between Thr160 and Lys124 and between Thr160 and His198, as well as that between His159 and Lys124, is increased, with respect to wild-type apyrase. Furthermore, the model predicts the formation of two putative additional direct hydrogen bonds, one between Asp202 and Ser157, with a length of 2?97 A˚, and the other between Thr160 and Ser157, with a length of 2?91 A˚.
DISCUSSION The apy gene, whose expression is co-regulated with that of virulence genes, is considered a pathogenesis-associated gene of Shigella and EIEC (Berlutti et al., 1998; Santapaola et al., 2002). In this work, by using random and site-directed mutagenesis, we provide further insights into the structure– function relationship of apyrase of EIEC strain HN280. Although apyrase shares striking sequence similarity, and common architecture and design, with A-NSAPs, it presents peculiar differences in enzymic activity and substrate specificity (Berlutti et al., 1998; Santapaola et al., 2002; Rossolini et al., 1998; Barghava et al., 1995). Analysis of randomly induced apy mutants identified single amino acid substitutions (S157P and R192P) located within the D2 and D3 domains, respectively, which lead to apyrase inactivation, as expected for two amino acids (S157 and R192) suggested to be important for the formation of the putative active site of apyrase (Babu et al., 2002; Ishikawa et al., 2000). These results add new evidence on the structural relationship of the putative active site of apyrase and confirm the importance of the D2 and D3 conserved domains for enzyme activity. We could not evaluate the importance of the D1 domain, the other conserved domain implicated in the formation of the putative active site of Microbiology 151
Structure–function relationship of apyrase of EIEC
(a)
(b)
Fig. 2. Relative orientation of Ala160 and Thr160 in wild-type and A160T mutant apyrase, respectively, relative to residues forming the putative active site of apyrase. (a) Wild-type apyrase; (b) A160T mutant apyrase. Dashed green lines represent hydrogen bonds. The figure was generated using DeepView/ Swiss Pdb Viewer 3.7 and Pov-Ray 3.6.
apyrase, since we did not isolate mutants within this domain. However, mutations leading to inactivation of apyrase were also found outside the D2 and D3 conserved domains (S97P and E233G, located in the N- and Cterminal parts of the protein, respectively), indicating that amino acids other than those indicated to form the putative active site are important for apyrase activity. We exclude that apyrase inactivation in these two mutants may be due to gross alterations of protein folding, since anti-apyrase polyclonal antibodies recognized the two mutant proteins. As far as the four mutants presenting modified enzyme specificity are concerned, all harbour an identical nucleotide substitution which leads to the H116L amino acid exchange. In contrast to His6-tagged wild-type apyrase, purified His6recombinant H116L apyrase is able to hydrolyse, albeit to a http://mic.sgmjournals.org
low extent, monophosphates, a feature typical of A-NSAPs. On the other hand, its optimum activity towards ATP is at the same pH and of the same extent (same Km value) as the His6-tagged wild-type apyrase. These results suggest that the ability of the H116L recombinant apyrase to hydrolyse monophosphates might not be due to an H116L substitution-induced overall increase of dephosphorylating activity, but rather to structural modifications specifically induced by this residue substitution. Our data do not rule out the participation of residues other than His116 in determining the apyrase specificity profile. A remarkable difference between apyrase and A-NSAPs is the residue next to His of the PSGH D2 domain which is involved in the formation of the phospho-intermediate in EB-NSAP (Ishikawa et al., 2000). This residue is Ala (Ala160) in apyrase and Thr in all A-NSAPs sequenced so far. As a consequence of the above considerations, it has been proposed that Ala160 in apyrase and Thr in A-NSAPs might dictate the differences in enzyme specificity of these proteins (Babu et al., 2002). To test this hypothesis, we introduced the A160T substitution in apyrase by sitespecific mutagenesis. Unexpectedly, all A160T mutants tested produced colourless colonies on M-TPMG plates and crude bacterial extracts failed to show any dephosphorylating activity, clearly indicating that the A160T substitution completely abolishes enzyme activity. These results strongly indicate that, rather than dictating enzyme specificity, residue Ala160 may be necessary for apyrase activity. To get further insights into the structural modifications introduced by the A160T substitution, a three-dimensional model of wild-type apyrase and of the A160T apyrase mutant was constructed by threading, using the Geno3D-model with EB-NSAP as PDB model. In silico analysis suggests that the A160T substitution might consistently modify the spatial distribution of the eight residues forming the putative active site of apyrase (Fig. 2). In particular, the distances between Ser157 and T160 and between Ser 157 and Asp202 are compatible with the formation of two additional direct hydrogen bonds. Moreover, we found an increase in the relative distance between the new substituted residue (Thr160) and residues thought to form the putative active site and between residues (H159 and Lys124) participating in the putative active site. These alterations of the threedimensional structure of the enzyme may well account for the inactivation of apyrase. The presence of the phoN-Sf gene, encoding a typical ANSAP, on a conserved DNA region of the pINV of the vast majority of Shigella and of some EIEC, supports the hypothesis that apyrase might have originated by duplication and mutation of an ancestral A-NSAP-encoding gene (Uchiya et al., 1996; Babu et al., 2002). Our results add new knowledge and further support the hypothesis that apyrase might be considered a variant of A-NSAPs (Rossolini et al., 1998), likely originating from substitutions of selected residues which determined the differences in enzyme specificity. The acquisition of apyrase by Shigella and EIEC might have 2859
S. Sarli and others
contributed to increasing the fitness of these enteric pathogens within host intestinal tissues. An understanding of the structure–function relationship of apyrase may contribute to our knowledge of the still unknown role of this enzyme in these enteroinvasive pathogens.
Komoszynki, M. & Wojtczak, A. (1996). Apyrase (ATP diphos-
phohydrolase, EC 3.6.1.5): function and relationship with ATPases. Biochim Biophys Acta 1310, 233–241. Mantis, N., Prevost, M. C. & Sansonetti, P. J. (1996). Analysis of
epithelial cell stress response during infection by Shigella flexneri. Infect Immun 64, 2474–2482. Mihara, Y., Utagawa, T., Yamada, H. & Asano, Y. (2000).
ACKNOWLEDGEMENTS
Phosphorylation of nucleosides by the mutated acid phosphatase from Morganella morganii. Appl Environ Microbiol 66, 2811–2816.
The authors thank E. Chiancone for helpful discussions and comments. For this study, Faculty funds were granted to F. B. and M. N. and MIUR, PRIN Project ‘Effettori di virulenza in patogeni enterici: caratteristiche e studio delle loro interazioni’ funds to M. N.
Rossolini, G. M., Schippa, S., Riccio, M. L., Berlutti, F., Macaskie, L. E. & Thaller, M. C. (1998). Bacterial nonspecific acid phosphohy-
drolases: physiology, evolution and use as tools in microbial biotechnology. Cell Mol Life Sci 54, 833–850. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
REFERENCES
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Amano, T., Wakagi, T. & Oshima, T. (1993). An ecto-enzyme from
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with
Sulfolobus acidocaldarius strain 7 which catalyzes hydrolysis of inorganic pyrophosphate, ATP, and ADP: purification and characterization. J Biochem 114, 329–333.
Santapaola, D., Casalino, M., Petrucca, A., Presutti, C., Zagaglia, C., Berlutti, F., Colonna, B. & Nicoletti, M. (2002). Enteroinvasive
Babu, M. M., Kalamalakkannan, S., Subrahmanyam, Y. V. B. K. & Sankaran, K. (2002). Shigella apyrase – a novel variant of bacterial
acid phosphatases? FEBS Lett 512, 8–12. Berlutti, F., Casalino, M., Zagaglia, C., Fradiani, P. A., Visca, P. & Nicoletti, M. (1998). Expression of the virulence plasmid-carried
apyrase gene (apy) of enteroinvasive Escherichia coli and Shigella flexneri is under the control of H-NS and the VirF and VirB regulatory cascade. Infect Immun 66, 4957–4964. Bhargava, T., Datta, S., Ramakrishnan, V., Roy, R. K., Sankaran, K. & Subrahmanyam, Y. V. B. K. (1995). Virulent Shigella codes for a
soluble apyrase: identification, characterization and cloning of the gene. Curr Sci 68, 293–300. Bradford, M. M. (1976). A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 72, 248–254. Buchrieser, C., Glaser, P., Rusniok, C., Nedjari, H., d’Hauteville, H., Kunst, F., Sansonetti, P. J. & Parsot, C. (2000). The virulence plasmid
pWR100 and the repertoire of proteins secreted by the type III secretion apparatus of Shigella flexneri. Mol Microbiol 38, 760–771. Cadwell, R. C. & Joyce, G. F. (1992). Randomization of genes by
PCR mutagenesis. PCR Methods Appl 2, 28–33. Cadwell, R. C. & Joyce, G. F. (1994). Mutagenic PCR. PCR Methods
Appl 3, S136–S140. Ishikawa, K., Mihara, Y., Gondoh, K., Suzuki, E. & Asano, Y. (2000).
X-ray structures of a novel acid phosphatase from Escherichia blattae and its complex with the transition-state analog molybdate. EMBO J 19, 2412–2423.
2860
chain-terminating inhibitors. Proc Natl Acad Sci U S A 74, 5463–5467.
Escherichia coli virulence-plasmid-carried apyrase (apy) and ospB genes are organized as a bicistronic operon and are subject to differential expression. Microbiology 148, 2519–2529. Segel, I. H. (1975). Enzyme Kinetics, Behaviour and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems. New York: Wiley. Stukey, J. & Carman, G. M. (1997). Identification of a novel
phosphatase sequence motif. Protein Sci 6, 469–472. Thaller, M. C., Berlutti, F., Schippa, S., Iori, P., Passariello, C. & Rossolini, G. M. (1995). Heterogeneous patterns of acid phosphatases
containing low-molecular-mass polypeptides in members of the family Enterobacteriaceae. Int J Syst Bacteriol 45, 255–261. Thaller, M. C., Berlutti, F., Schippa, S., Selan, L. & Rossolini, G. M. (1998). Bacterial acid phosphatase gene fusions useful as targets
for cloning-dependent insertional inactivation. Biotechnol Prog 14, 241–247. Uchiya, K. I., Tohsuji, M., Nikai, T., Sugihara, H. & Sasakawa, C. (1996). Identification and characterization of phoN-Sf, a gene on
the large plasmid of Shigella flexneri 2a encoding a nonspecific phosphatase. J Bacteriol 178, 4548–4554. Venkatesan, M. M., Goldberg, M. B., Rose, D. J., Grotbeck, E. J., Burland, V. & Blattner, F. R. (2001). Complete DNA sequence and
analysis of the large virulence plasmid of Shigella flexneri. Infect Immun 69, 3271–3285. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13
phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119.
Microbiology 151
DOI 10.1099/mic.0.28142-0
Ala160 and His116 residues are involved in activity and specificity of apyrase, an ATP-hydrolysing enzyme produced by enteroinvasive Escherichia coli Serena Sarli,1 Mauro Nicoletti,2 Serena Schippa,1 Federica Del Chierico,1 Daniela Santapaola,2 Piera Valenti3 and Francesca Berlutti1 1
Dipartimento di Scienze di Sanita` Pubblica, Universita` di Roma ‘La Sapienza’, Piazzale A. Moro, 5 00185 Rome, Italy
Correspondence Francesca Berlutti [email protected]
2
Dipartimento di Scienze Biomediche, Sezione di Microbiologia, Universita` G. D’Annunzio, Chieti, Italy
3
Dipartimento di Medicina Sperimentale, Seconda Universita`, Naples, Italy
Received 21 April 2005 Revised 22 June 2005 Accepted 23 June 2005
The virulence plasmid-carried apy (phoN2) gene of Shigella and related enteroinvasive Escherichia coli (EIEC) encodes apyrase, an ATP-diphosphohydrolase belonging to class A of the non-specific acid phosphatases (A-NSAPs). Apyrase and A-NSAPs share three domains of conserved amino acids (domains D1–D3) containing residues forming the putative active site of apyrase. In spite of their similarity, apyrase and A-NSAPs show different substrate specificity, apyrase being able to hydrolyse nucleotide tri- and diphosphates, but not monophosphates, as well as p-nitrophenyl phosphate (pNPP), while A-NSAPs are also active towards monophosphates and pNPP. In this paper, to get further insights into the structure–function relationship of apyrase, a random and site-directed mutagenesis of the apy gene of EIEC strain HN280 was conducted. Results indicate that amino acids located within the D2 and D3 conserved domains (Ser157 and Arg192, respectively) as well as residues located in the N-terminal (Ser97) and C-terminal (Glu233) domains are required for enzyme activity. Surprisingly, Ala160, located near the D2 domain and considered to be important for enzyme specificity, is required for enzyme activity, as its substitution with Thr led to the inactivation of enzyme activity. Furthermore, residue His116 is involved in apyrase specificity, since the H116L apyrase mutant shows substrate specificity resembling that of A-NSAPs.
INTRODUCTION Apyrases are ATP-diphosphohydrolase enzymes (EC 3.6.1.5) commonly found in eukaryotic cells, where they play an important role in the control of cellular nucleotide levels (Komoszynki & Wojtczak, 1996). In prokaryotes, apyrases have so far been found only in Shigella and related enteroinvasive Escherichia coli (EIEC) strains, and in the thermoacidophilic archaeon Sulfolobus acidocaldarius (Amano et al., 1993; Berlutti et al., 1998; Bhargava et al., 1995). Apyrase of EIEC and of Shigella flexneri is encoded by the virulence plasmid (pINV)-encoded apy (phoN2) gene (Buchrieser et al., 2000; Venkatesan et al.; 2001; Santapaola Abbreviations: EIEC, enteroinvasive Escherichia coli; NSAPs, nonspecific acid phosphatases; A-NSAPs, class A of non-specific acid phosphatases; pNPP, p-nitrophenyl phosphate; PDP, phenolphthalein diphosphate tetrasodium salt.
0002-8142 G 2005 SGM
Printed in Great Britain
et al., 2002), whose sequence is highly conserved in both species (the apyrase of EIEC strain HN280 differs in primary amino acid sequence from that of S. flexneri strain M90T only by one residue located at its N-terminus) (Santapaola et al., 2002; SWISS-PROT/TrEMBL accession numbers Q99QG5 and Q93IG8). Apyrase is a 27 kDa protein which utilizes the Sec machinery for its secretion across the inner membrane (Bhargava et al., 1995; Santapaola et al., 2002). Even though a specific role has not yet been assigned, apyrase has been considered as a pathogenesis-associated enzyme, possibly involved either in mitochondrial damage and host cell death, or in the Shigella- and EIEC-induced process of actin polymerization (Bhargava et al., 1995; Mantis et al., 1996; Berlutti et al., 1998; Santapaola et al., 2002). Because of its similarity, apyrase has been included in class A of the non-specific bacterial acid phosphatases (A-NSAPs) (EC 3.1.3.2), which also includes PhoN-Sf of S. flexneri, 2853
S. Sarli and others
PhoN of Salmonella enterica ser. Typhi, PhoC of Morganella morganii, PhoN of Providencia stuartii, PhoC of Zymomonas mobilis and EB-NSAP of Escherichia blattae (Rossolini et al., 1998; Ishikawa et al., 2000). In spite of its similarity, apyrase shows a substrate specificity distinct from that of A-NSAPs. While apyrase is able to sequentially hydrolyse nucleoside tri- and diphosphates to the corresponding diphosphates and monophosphates, but is not active against monophosphates, A-NSAPs are also able to hydrolyse monophosphates. Moreover, in contrast to A-NSAPs, apyrase is scarcely active towards p-nitrophenyl phosphate (pNPP) (Babu et al., 2002; Bhargava et al., 1995; Rossolini et al., 1998) and has an optimum pH of 7?5 (6?0–6?5 for ANSAPs) (Bhargava et al., 1995; Rossolini et al., 1998). Few data are presently available on the structure–function relationships of apyrase and A-NSAPs. Sequence alignment has identified three domains of conserved amino acids, namely the K(X6)RP domain (D1), the PSGH domain (D2) and the SR(X5)H(X3)D domain (D3) (Stukey & Carman, 1997; Mihara et al., 2000; Babu et al., 2002). Recently, the three-dimensional structure of EB-NSAP of E. blattae has been determined and its active site consists of eight residues contained within the three conserved (D1–D3) domains, namely the Lys and Arg residues within the D1 domain, the Ser, Gly and His residues within the D2 domain, and the Arg, His and Asp residues within the D3 domain (Ishikawa et al., 2000). Based on the high degree of similarity between EB-NSAP and apyrase (50 % overall identity and 73 % similarity), a putative three-dimensional structure of apyrase has been proposed and a putative active site, consisting of the above-mentioned eight residues, has been hypothesized (Babu et al., 2002). Interestingly, the residue next to His of the PSGH D2 domain is Thr in EB-NSAP as well as in all ANSAPs sequenced so far, while it is Ala (Ala160) in apyrase. As the His residue of the PSGH D2 domain of E. blattae has been reported to be involved in the formation of the phospho-intermediate (Ishikawa et al., 2000), it has been speculated that Ala160 of apyrase might be important in dictating apyrase substrate specificity (Babu et al., 2002). To get further insights into the structure–function relationship of apyrase, we have performed PCR-based random and site-directed mutagenesis of the apy gene of EIEC strain HN280 (Berlutti et al., 1998). Analysis of randomly generated mutants indicates that mutations (amino acid substitutions) leading to apyrase inactivation occur, as expected, within the D2 and D3 conserved domains (residues Ser157 and Arg192, respectively) as well as within residues not involved in the putative active site, such as Ser97 and Glu233, which are located within the N- and Ctermini of apyrase. Unexpectedly, our results indicate that Ala160 is also important for enzyme activity and not for substrate specificity, as its substitution with Thr leads to the inactivation of the enzyme. In contrast, His116 seems to be involved in apyrase specificity, as the H116L apyrase mutant is able to dephosphorylate monophosphates, though to a low extent. 2854
METHODS Bacterial strains, plasmids and culture conditions. The bacter-
ial strains and plasmids used are listed in Table 1. Growth media were Terrific broth (TB) and Luria broth (LB) medium supplemented with glucose (1 % final concentration) (Sambrook et al., 1989). The solid media contained 1?5 % agar. A modified Tryptose phosphate/phenolphthalein/methyl green (M-TPMG) agar medium was used to detect apyrase activity on plates (Thaller et al., 1998). MTPMG plates were made of Tryptose-phosphate agar (Difco) dissolved in 50 mM phosphate buffer (pH 7?2) supplemented with 1 % (final concentration) glucose, 2 mg phenolphthalein diphosphate tetrasodium salt (PDP) (Sigma) ml21 and 50 mg methyl green (Sigma) ml21. On these plates, apyrase-positive strains produce green colonies, whereas apyrase-negative strains produce white colonies. Antibiotics were used at the following concentrations: 100 mg ampicillin ml21; 30 mg kanamycin ml21. IPTG was used at 1 mM to induce expression of His6-tagged recombinant proteins. General DNA manipulations. All basic recombinant DNA proce-
dures, such as extraction of plasmid DNA, PCR, restriction enzyme digestion, ligation of DNA fragments, and transformation of E. coli, were performed as described by Sambrook et al. (1989). Construction and isolation of apyrase mutants. A 1032 bp
DNA fragment, containing the entire apy gene of EIEC strain HN280 (GenBank no. AJ315184), was PCR-amplified with proofreading Taq polymerase (New England BioLabs), using pHN99 plasmid as DNA template and the primer pair FB30 and FB31 (Table 2). The amplified DNA fragment was cloned into the SmaI site of pUC18, thus giving rise to plasmid pFB1 (Table 1). Random mutations were introduced throughout the apy-coding region carried by plasmid pFB1. Error-prone PCR was performed as previously described (Cadwell & Joyce, 1992, 1994), under conditions of low fidelity. Reaction mixtures contained 16 PCR buffer (New England BioLabs), 30 pmol each primer FB30 and FB31, 20 fmol template pFB1 plasmid DNA, 5 units Taq polymerase and 5 % glycerol, in a total volume of 50 ml. Samples were subjected to 30 cycles, each cycle comprising 1 min denaturation at 96 uC, 2 min primer annealing at 42 uC and 3 min extension with Taq polymerase at 72 uC. The resulting PCR fragments were digested with PvuII–XbaI and an 849 bp fragment encompassing the entire apy gene was recovered from a 1 % agarose gel and ligated between the EcoV and the XbaI sites of plasmid pBluescript SK (Stratagene). The ligation mixture was used to transform E. coli strain DH5a competent cells. Recombinant clones, containing PCR-generated apy mutants, were isolated on M-TPMG plates. To construct an apyrase mutant with the amino acid A160T substitution (amino acids are numbered according to SWISS-PROT/ TrEMBL entry Q93IG8), the FBA160TF and FBA160TR primers (Table 2) were designed in order to substitute nucleotide G with A in the GCA codon of Ala160. PCR experiments were carried out using plasmid pFB1 as template and an in vitro mutagenesis kit (QuickChange Site-Directed Mutagenesis kit, Stratagene), as recommended by the manufacturer. PCR was carried out with programmes of 16 cycles, each cycle comprising 45 s denaturation at 96 uC, 1 min primer annealing at 55 uC and 5 min extension with PfuUltra High Fidelity DNA Polymerase (New England BioLabs) at 68 uC. Amplified DNA fragments were digested with DpnI and 1 ml aliquots were ligated and the ligation mixture used to transform E. coli DH5a competent cells. Plasmid DNA preparations from independent transformants were assayed for an expected loss of an NsiI restriction site. Three independent positive clones were detected, and sequence analysis indicated that all three carried the expected Thr ACA codon instead of the Ala GCA codon. No other nucleotide change appeared within the apy-coding region of the three independent mutants. Microbiology 151
Structure–function relationship of apyrase of EIEC
Table 1. Bacterial strains and plasmids used in this study Strain/plasmid
Relevant characteristics
HN280 E. coli DH5a E. coli M15(pREP4) pBluescript SK pUC18 pQE30 pHN99 pFB1 pFB1-4, pFB1-16, pFB1-34, pFB1-83, pFB1-500, pFB1-700, pFB1-710, pFB1-821 pFB1-104, pFB1-127, pFB1-162 pFBQ-N pFBQ-500
Source/reference
Wild-type EIEC strain of serotype O135 : K2 : H2, contains pINV pHN280; apy+ F2 080dlacZDM15 D(lacZYA–argF)U169 deoR recA1 endA1 z hsdR17(r{ k m k ) phoA supE44 1- thi-1 gyrA96 relA1 Host for expression vector pQE30 carrying pREP4 (lacI q Kmr p14A ori), Kmr Cloning plasmid vector; Ampr Cloning plasmid vector; Ampr Expression plasmid vector; Ampr pACYC177-derived vector carrying the 8023 bp PstI apy-encoding DNA fragment of pHN280; apy+ pUC18-derived plasmid carrying the 1032 bp apy-encoding DNA fragment of pHN99; apy+ Independent pFB1-derived plasmids from random mutagenesis experiments Independent pFB1-derived plasmids containing the apyA160T substitution pQE30-derived plasmid carrying a 671 bp DNA fragment from pFB1 encoding wild-type apyrase pQE30-derived plasmid carrying a 671 bp DNA fragment from pFB1 encoding H116L mutant apyrase
Construction and purification of His6-tagged recombinant proteins. FBB and FBH primers (Table 1) were used to amplify the
apy gene from plasmids pFB1 and pFB1-500, which carried wildtype and apyH116L mutant genes, respectively (Table 2). The two PCR-generated fragments were digested with BamHI and HindIII and cloned separately between the BamHI and HindIII sites of the polylinker of plasmid pQE30 (Qiagen), thus generating plasmids pFBQ-N and pFBQ-500, respectively. Plasmid pFBQ-N carries the wild-type apy gene encoding mature wild-type enzyme, and pFBQ500 carries the apyH116L mutant gene encoding mature H116L mutant apyrase. Both fragments were cloned in-frame with the His6-coding sequence of pQE30 and recombinant plasmids were transformed separately into E. coli M15 (pREP4) (Table 1). Recombinant proteins carrying a His6-tag were purified using nickelnitrilotriacetic acid (Ni-NTA) agarose resin (Qiagen), according to the manufacturer’s protocol. Briefly, M15 (pREP4) bacteria harbouring either pFBQ-N or pFBQ-500 were grown in 500 ml LB at 37 uC until
Berlutti et al. (1998) Promega Qiagen Stratagene Inc., La Jolla, CA Yanisch-Perron et al. (1985) Qiagen Santapaola et al. (2002) This study This study
This study This study This study
the OD600 of the culture reached 0?8, and IPTG was added to a final concentration of 1 mM. After 2 h induction at 37 uC, bacteria were harvested by centrifugation and suspended in lysis buffer (50 mM Na2HPO4, 300 mM NaCl, 30 mM imidazole, pH 8) supplemented with 1 mg lysozyme ml21, incubated on ice for 30 min and sonicated eight times for 30 s in a Soniprep MSE 150 apparatus (Sanyo; frequency 23 kHz, amplitude 15 mm). Cleared lysates were prepared by centrifugation of the sonicated extracts at 15 000 g for 30 min at 4 uC, mixed with 2 ml Ni-NTA agarose resin and incubated for 2 h at 4 uC with gentle agitation. The resin was washed extensively with lysis buffer containing 50 mM imidazole and proteins bound to the resins were eluted with elution buffer (50 mM Na2HPO4, 300 mM NaCl, pH 8?0) containing increasing concentrations (70, 100, 150, 200 and 500 mM) of imidazole and collected in 500 ml fractions. Eluted proteins were analysed by SDS-PAGE, either stained with Coomassie brilliant blue, or transferred to PVDF membrane and probed with mouse polyclonal antibodies against apyrase or with mouse monoclonal antibodies against the His6-tag (Qiagen). The activity of the two
Table 2. Oligonucleotides used in this study Primer FB30 FB31 FBA160TF FBA160TR FBB FBH
Sequence* (5§–3§)
LocationD
CATCATAATACAGAGACAAAACG AGATCTATGCTCATATAGGGTAGATT TGGCTCTTATCCCTCTGGTCATACATCCTTTG CAAAGGATGTATGACCAGAGGGATAAGAGCCA GGGGGGATCCCTGAAGGCAGAAGGTTTT GGGGAAGCTTATGGGGTCAGTTCATTGGT
4716–4739 5729–5749 5403–5434 5403–5434 5017–5034 5668–5687
Features Used to construct pFB1 Used to construct pFB1-104, pFB1-127, pFB1-162 Used to construct pFBQ-N, pFBQ-500
*Restriction sites introduced at the 59 end of the oligonucleotides are underlined. DThe nucleotide numeration was based on GenBank entry no. AJ315184. http://mic.sgmjournals.org
2855
S. Sarli and others recombinant apyrases towards different substrates was determined after overnight dialysis against 5 mM Tris/HCl buffer (pH 7?0), as described below. Enzyme assays. The apyrase activity of crude cell extracts and of purified His6-tagged enzymes was assayed at 37 uC in 200 ml 0?1 M Tris/HCl (pH 7?5), 1 mM ATP and 10 mM EDTA, as described by Bhargava et al. (1995). The reaction was stopped by the addition of 1 : 10 volume of trichloroacetic acid and the phosphates released were estimated. Protein concentrations were determined by the method of Bradford (1976), using a commercial kit (Bio-Rad), with BSA as standard. Enzyme activity was also assayed using the set of different substrates shown in Table 3. Enzyme activity towards pNPP was assayed using a reaction mixture that contained 100 mM Tris/HCl (pH 7?5), 10 mM EDTA and 5 mM pNPP in a total volume of 300 ml. The reaction was stopped by the addition of 700 ml 2 M NaOH and the release of p-nitrophenol was monitored by the measurement of absorbance at 414 nm.
10 % (w/v) ascorbic acid. Apyrase activity was visualized by the appearance on the gels after 10 min incubation at room temperature of a blue precipitate located at a migration distance corresponding to the Mr of the polypeptide component of the renatured enzyme. When PDP was used as substrate, after renaturation the gels were equilibrated for 1 h in several changes of 100 mM sodium acetate buffer (pH 6?0). Enzyme activity was visualized by the addition of 4 mM PDP and 50 mM methyl green to the equilibration buffer and was indicated by the presence of green bands after overnight incubation at 37 uC. Western blot analysis. Whole bacterial extracts were prepared and separated by SDS-PAGE. Gels were either stained with Coomassie brilliant blue or transferred to PVDF membranes (Amersham) and subjected to Western blot analysis, using mouse anti-apyrase polyclonal (1 : 2500) or anti-His6-tag (1 : 7500) monoclonal antibodies (Qiagen). Horseradish peroxidase-labelled rabbit anti-mouse secondary antibodies were used as secondary antibodies and visualized by enhanced chemiluminescence. DNA sequencing and computer analysis. Nucleotide sequences
The optimum pH was assayed in 50 mM sodium acetate (pH range 4–6?5) or in 50 mM Tris/HCl (pH range 6?0–9?5), using 1 mM ATP as substrate. Kinetic constants for ATP and pNPP were determined under the assay conditions described above, and calculated by using a Lineweaver– Burk plot (Segel, 1975). The procedure for zymogram detection of phosphatase activity was performed as previously described (Berlutti et al., 1998; Thaller et al., 1995). Briefly, crude cell extracts were separated by 12?5 % SDS-PAGE. After electrophoresis, the gels were incubated 3 h at 37 uC in several changes of renaturation buffer [50 mM Tris/HCl (pH 7?0), 1 % (v/v) Triton X-100] to obtain apyrase renaturation. To evaluate ATPhydrolysing activity, after renaturation, the gels were equilibrated for 1 h in several changes of 100 mM Tris/HCl (pH 7?5) and incubated for 30 min at approximately 10 uC in 100 mM Tris/HCl (pH 7?5), 10 mM EDTA and 1 mM ATP. Enzyme activity was visualized by immersing the gels in a 4 : 1 (v/v) freshly prepared solution of acidified ammonium molybdate (5 mM ammonium molybdate, 0?12 M sulphuric acid) and
Table 3. Activity of purified His6-tagged wild-type and H116L mutant apyrase The values are relative to that of ATP, which is set as 100 %. Substrate
ATP 59-AMP 39-AMP ADP 59-UMP 39-UMP 39-GMP 59-GMP 39-CMP 59-CMP Glucose 1-phosphate Glucose 6-phosphate Ribose 5-phosphate pNPP
2856
Relative activity (%) Wild-type
H116L mutant
100±2 0?1±0?01 0?2±0?03 59?7±4?3 2?7±1?1 1?1±0?01 0?2±0?01 1?4±0?5 0?2±0?03 0?2±0?02 0?2±0?01 0?3±0?03 0?3±0?01 1?0±0?01
100±2?5 0?7±0?09 1?2±0?01 67?5±5?1 6?7±2?9 6?1±1?7 1?0±0?03 1?2±0?03 1?1±0?04 1?3±0?01 0?8±0?09 1?6±0?03 1?3±0?1 14?3±0?9
were determined on denatured double-stranded DNA templates using the dideoxy-chain-termination method (Sanger et al., 1977). The nucleotide sequence was determined for both strands. Sequence data were compared using the FASTA 3 algorithm (http://www.ebi. ac.uk/fasta33/) and the deduced amino acidic sequences were aligned using the CLUSTAL W program (http://www.ebi.ac.uk/clustalw/). Modelling of wild-type and apyrase mutant was obtained by threading using the Geno3D-model (http://geno3d-pbil.ibcp.fr/cgi-bin/ geno3d_automat.pl?page=/GENO3D/geno3d_home.html) with EBNSAP as PDB model (1D2T).
RESULTS Isolation of apy mutants by random mutagenesis A mutational analysis (random and site-directed) of the apy gene cloned from EIEC strain HN280 was conducted to investigate the structure–function relationship of apyrase. Plasmid pFB1 (Table 1) was used to introduce mutations into the apy gene by error-prone PCR and a pBluescript SK-based mutant library was constructed in E. coli DH5a, as described in Methods. M-TPMG plates were used in order to screen recombinant clones. On these plates, apyrase-producing DH5a (pFB1) (positive-control strain) forms green colonies after 24 h incubation at 37 uC while apyrase-negative strains DH5a, DH5a (pUC18) and DH5a (pBluescript SK) produce colourless colonies (negativecontrol strains). Out of more than 12 000 recombinant colonies examined, 40 were selected as colourless and six as hyper-green colonies on M-TPMG plates. Colourless and hyper-green colonies were taken for further investigation. Of these, 36 colourless and two hyper-green clones were not investigated further because they harboured plasmids presenting unexpected molecular rearrangements, or because they scored negative in Western blots conducted using anti-apyrase polyclonal antibodies. The apyrase activity of the remaining four colourless clones was assayed against ATP and pNPP, and by zymogram against ATP and PDP, as substrates. While the crude cell extract of E. coli DH5a (pFB1) was active on ATP (but not on pNPP) and contained a protein able to Microbiology 151
Structure–function relationship of apyrase of EIEC
dephosphorylate ATP (but not PDP) of the expected size of mature apyrase (zymogram analysis), cell extracts of the four colourless clones (DH5a carrying pFB1-4, pFB1-16, pFB1-34 or pFB1-83) did not show enzyme activity (Fig. 1). Western analysis indicated that all four colourless clones are able to synthesize a protein which is recognized by apyrasespecific antibodies (data not shown). DNA sequencing of the recombinant plasmids enabled detection of the mutations within the apy-coding region. pFB1-4, pFB1-34 and pFB1-16 carry single non-conservative amino acid substitutions (R192P, located within the D3 domain, S157P, located within the D2 domain, and E233G, located within the Cterminus region, respectively), while pFB1-83 presents a double substitution, a conservative one (I194V) within the D3 domain, and a non-conservative one (S97P) within the N-terminus (Fig. 1). Of the remaining four hyper-green apyrase mutants (DH5a carrying plasmids pFB1-500, pFB1-700, pFB1-710 or pFB1821), all show altered substrate specificity, since bacterial extracts hydrolysed both ATP and pNPP. Moreover, zymogram analysis identified a protein of the size of mature apyrase active towards both ATP and PDP (Fig. 1). Sequencing recognized an identical A to T substitution, which changes the CAT in a CTT codon, leading to the
substitution of His116 for Leu116. Taken together, these data strongly suggest that His116 might be important in dictating apyrase specificity. Specific activity and kinetic analysis of the H116L apyrase mutant To better characterize enzymic activity and substrate specificity of the H116L apyrase, recombinant plasmids pFBQ-N and pFBQ-500 were constructed (Table 1). His6-tagged recombinant wild-type and H116L mutant apyrase were purified to approximately 90 % homogeneity and were both recognized in Western blot experiments by antibodies directed against apyrase or against the His6-tag (data not shown). Purified His6-tagged wild-type and H116L apyrase mutant proteins show a pH optimum at 7?5. About 50 % of the enzyme activity is retained in the pH range 5–8?5. Next, enzyme activity was evaluated at pH 7?5 against different substrates. As shown in Table 3, wild-type and H116L mutant apyrase exhibit different substrate specificities. As expected, wild-type apyrase is able to dephosphorylate only ATP and ADP, while mutant apyrase exhibits a broad substrate activity, being able to dephosphorylate, even if at a low extent, various monophosphates. The more relevant
Fig. 1. Wild-type and recombinant apyrases, obtained by random and site-directed mutagenesis of the apy gene of the EIEC strain HN280. Amino acid numeration is based on the apyrase sequence of SWISS-PROT/TrEMBL accession number Q93IG8. Wild-type apyrase spans 246 residues. L (dotted area), leader sequence; D1, K(6X)RP conserved domain 1, 124–132 residues; D2, PSGH conserved domain 2, 156–159 residues; D3, SR(5X)H(3X)D conserved domain 3, 191–202 residues. ATP values are expressed as pmol Pi (mg protein)”1 min”1. pNPP values are expressed as pmol p-nitrophenol (mg protein)”1 min”1. http://mic.sgmjournals.org
2857
S. Sarli and others
Table 4. Kinetic parameters of purified His6-tagged wild-type and H116L mutant apyrase using ATP and pNPP as substrates Enzyme
Wild-type H116L mutant
ATP ”1
Km (mM)
kcat (s )
21±0?5 24±0?7
374±5 188±2
pNPP ”1
kcat/Km (M
1?861027 7?861026
”1
s )
Km (mM)
kcat (s”1)
kcat/Km (M”1 s”1)
15±1?9 3?5±0?8
12±0?2 42±0?7
861022 1?261024
difference between wild-type and H116L mutant apyrase is observed in the ability of the latter to dephosphorylate pNPP (about 14-fold increase), 39-UMP and 39-AMP (about sixfold increase), and glucose 6-phosphate (about fivefold increase).
analysis, both of which failed to find any hydrolysing activity (Fig. 1), while Western analysis revealed the presence of a protein of a molecular size corresponding to apyrase (data not shown). These data indicate that Ala160 is important for apyrase activity and not for specificity.
The steady-state kinetic parameters of wild-type and H116L mutant apyrase at pH 7?5 are reported in Table 4. Steadystate kinetic parameters have been also determined at pH 6?5 and 8?5 for ATP and pNPP. As far as ATP is concerned, whereas kcat values show a distinct maximum at pH 7?5 and decrease significantly at lower and higher pH values, Km values for both wild-type and H116L mutant apyrase decrease steadily over the range 6?5–8?5 (from 58 and 84 mM at pH 6?5 to 11 and 13 mM at pH 8?5, for His6tagged wild-type and H116L apyrase, respectively). As far as pNPP is concerned, the kcat values recorded for both His6tagged wild-type and H116L mutant apyrase show a distinct maximum at pH 7?5 and decrease significantly at lower and higher pH values, and the respective Km values demonstrate a distinct minimum value at pH 7?5 and increase significantly at lower and higher pH values (210 and >250 mM at pH 6?5 and 8?5, respectively, for wild-type apyrase, and 16 and 75 mM at pH 6?5 and 8?5, respectively, for H116L apyrase). At the optimum pH, the H116L mutation induces a moderate increase of the Km value for ATP and a significant decrease for pNPP. Moreover, the replacement of His116 with Leu increases the catalytic efficiency of the enzyme, as demonstrated by the kcat/Km ratio for pNPP.
Structural analysis of the A160T apyrase mutant
Site-directed mutagenesis It has been recently hypothesized that residue Ala160 next to His159 of the PSGH conserved D2 domain of apyrase might be involved in enzyme specificity, since in all ANSAPs sequenced so far the residue corresponding to Ala160 is invariably Thr (Mihara et al., 2000; Babu et al., 2002). To assess whether Ala160 plays any role in determining apyrase specificity, we substituted this residue with Thr by site-directed mutagenesis (as described in Methods). Three independent DH5a mutants, harbouring plasmids pFB1104, pFB1-127 or pFB1-162 (Fig. 1), were analysed, and the introduction of the correct nucleotide substitution was confirmed by DNA sequencing. Unexpectedly, all three mutants produce colourless colonies on M-TPMG plates, indicating that the A160T substitution might have induced apyrase inactivation. That this is the case was confirmed by the analysis of crude protein extracts and by zymogram 2858
The hypothetical three-dimensional structure of wild-type and A160T mutant apyrase was obtained by threading, using the Geno3D-model with EB-NSAP as PDB model (1D2T). The relative orientation of residues of the putative active site of wild-type apyrase was compared to that of A160T inactive apyrase (Fig. 2 a and b, respectively). The A160T mutant enzyme shows alterations of the spatial configuration of the putative active site, compared to that of wild-type apyrase. In particular, the distance between Thr160 and Lys124 and between Thr160 and His198, as well as that between His159 and Lys124, is increased, with respect to wild-type apyrase. Furthermore, the model predicts the formation of two putative additional direct hydrogen bonds, one between Asp202 and Ser157, with a length of 2?97 A˚, and the other between Thr160 and Ser157, with a length of 2?91 A˚.
DISCUSSION The apy gene, whose expression is co-regulated with that of virulence genes, is considered a pathogenesis-associated gene of Shigella and EIEC (Berlutti et al., 1998; Santapaola et al., 2002). In this work, by using random and site-directed mutagenesis, we provide further insights into the structure– function relationship of apyrase of EIEC strain HN280. Although apyrase shares striking sequence similarity, and common architecture and design, with A-NSAPs, it presents peculiar differences in enzymic activity and substrate specificity (Berlutti et al., 1998; Santapaola et al., 2002; Rossolini et al., 1998; Barghava et al., 1995). Analysis of randomly induced apy mutants identified single amino acid substitutions (S157P and R192P) located within the D2 and D3 domains, respectively, which lead to apyrase inactivation, as expected for two amino acids (S157 and R192) suggested to be important for the formation of the putative active site of apyrase (Babu et al., 2002; Ishikawa et al., 2000). These results add new evidence on the structural relationship of the putative active site of apyrase and confirm the importance of the D2 and D3 conserved domains for enzyme activity. We could not evaluate the importance of the D1 domain, the other conserved domain implicated in the formation of the putative active site of Microbiology 151
Structure–function relationship of apyrase of EIEC
(a)
(b)
Fig. 2. Relative orientation of Ala160 and Thr160 in wild-type and A160T mutant apyrase, respectively, relative to residues forming the putative active site of apyrase. (a) Wild-type apyrase; (b) A160T mutant apyrase. Dashed green lines represent hydrogen bonds. The figure was generated using DeepView/ Swiss Pdb Viewer 3.7 and Pov-Ray 3.6.
apyrase, since we did not isolate mutants within this domain. However, mutations leading to inactivation of apyrase were also found outside the D2 and D3 conserved domains (S97P and E233G, located in the N- and Cterminal parts of the protein, respectively), indicating that amino acids other than those indicated to form the putative active site are important for apyrase activity. We exclude that apyrase inactivation in these two mutants may be due to gross alterations of protein folding, since anti-apyrase polyclonal antibodies recognized the two mutant proteins. As far as the four mutants presenting modified enzyme specificity are concerned, all harbour an identical nucleotide substitution which leads to the H116L amino acid exchange. In contrast to His6-tagged wild-type apyrase, purified His6recombinant H116L apyrase is able to hydrolyse, albeit to a http://mic.sgmjournals.org
low extent, monophosphates, a feature typical of A-NSAPs. On the other hand, its optimum activity towards ATP is at the same pH and of the same extent (same Km value) as the His6-tagged wild-type apyrase. These results suggest that the ability of the H116L recombinant apyrase to hydrolyse monophosphates might not be due to an H116L substitution-induced overall increase of dephosphorylating activity, but rather to structural modifications specifically induced by this residue substitution. Our data do not rule out the participation of residues other than His116 in determining the apyrase specificity profile. A remarkable difference between apyrase and A-NSAPs is the residue next to His of the PSGH D2 domain which is involved in the formation of the phospho-intermediate in EB-NSAP (Ishikawa et al., 2000). This residue is Ala (Ala160) in apyrase and Thr in all A-NSAPs sequenced so far. As a consequence of the above considerations, it has been proposed that Ala160 in apyrase and Thr in A-NSAPs might dictate the differences in enzyme specificity of these proteins (Babu et al., 2002). To test this hypothesis, we introduced the A160T substitution in apyrase by sitespecific mutagenesis. Unexpectedly, all A160T mutants tested produced colourless colonies on M-TPMG plates and crude bacterial extracts failed to show any dephosphorylating activity, clearly indicating that the A160T substitution completely abolishes enzyme activity. These results strongly indicate that, rather than dictating enzyme specificity, residue Ala160 may be necessary for apyrase activity. To get further insights into the structural modifications introduced by the A160T substitution, a three-dimensional model of wild-type apyrase and of the A160T apyrase mutant was constructed by threading, using the Geno3D-model with EB-NSAP as PDB model. In silico analysis suggests that the A160T substitution might consistently modify the spatial distribution of the eight residues forming the putative active site of apyrase (Fig. 2). In particular, the distances between Ser157 and T160 and between Ser 157 and Asp202 are compatible with the formation of two additional direct hydrogen bonds. Moreover, we found an increase in the relative distance between the new substituted residue (Thr160) and residues thought to form the putative active site and between residues (H159 and Lys124) participating in the putative active site. These alterations of the threedimensional structure of the enzyme may well account for the inactivation of apyrase. The presence of the phoN-Sf gene, encoding a typical ANSAP, on a conserved DNA region of the pINV of the vast majority of Shigella and of some EIEC, supports the hypothesis that apyrase might have originated by duplication and mutation of an ancestral A-NSAP-encoding gene (Uchiya et al., 1996; Babu et al., 2002). Our results add new knowledge and further support the hypothesis that apyrase might be considered a variant of A-NSAPs (Rossolini et al., 1998), likely originating from substitutions of selected residues which determined the differences in enzyme specificity. The acquisition of apyrase by Shigella and EIEC might have 2859
S. Sarli and others
contributed to increasing the fitness of these enteric pathogens within host intestinal tissues. An understanding of the structure–function relationship of apyrase may contribute to our knowledge of the still unknown role of this enzyme in these enteroinvasive pathogens.
Komoszynki, M. & Wojtczak, A. (1996). Apyrase (ATP diphos-
phohydrolase, EC 3.6.1.5): function and relationship with ATPases. Biochim Biophys Acta 1310, 233–241. Mantis, N., Prevost, M. C. & Sansonetti, P. J. (1996). Analysis of
epithelial cell stress response during infection by Shigella flexneri. Infect Immun 64, 2474–2482. Mihara, Y., Utagawa, T., Yamada, H. & Asano, Y. (2000).
ACKNOWLEDGEMENTS
Phosphorylation of nucleosides by the mutated acid phosphatase from Morganella morganii. Appl Environ Microbiol 66, 2811–2816.
The authors thank E. Chiancone for helpful discussions and comments. For this study, Faculty funds were granted to F. B. and M. N. and MIUR, PRIN Project ‘Effettori di virulenza in patogeni enterici: caratteristiche e studio delle loro interazioni’ funds to M. N.
Rossolini, G. M., Schippa, S., Riccio, M. L., Berlutti, F., Macaskie, L. E. & Thaller, M. C. (1998). Bacterial nonspecific acid phosphohy-
drolases: physiology, evolution and use as tools in microbial biotechnology. Cell Mol Life Sci 54, 833–850. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
REFERENCES
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Amano, T., Wakagi, T. & Oshima, T. (1993). An ecto-enzyme from
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with
Sulfolobus acidocaldarius strain 7 which catalyzes hydrolysis of inorganic pyrophosphate, ATP, and ADP: purification and characterization. J Biochem 114, 329–333.
Santapaola, D., Casalino, M., Petrucca, A., Presutti, C., Zagaglia, C., Berlutti, F., Colonna, B. & Nicoletti, M. (2002). Enteroinvasive
Babu, M. M., Kalamalakkannan, S., Subrahmanyam, Y. V. B. K. & Sankaran, K. (2002). Shigella apyrase – a novel variant of bacterial
acid phosphatases? FEBS Lett 512, 8–12. Berlutti, F., Casalino, M., Zagaglia, C., Fradiani, P. A., Visca, P. & Nicoletti, M. (1998). Expression of the virulence plasmid-carried
apyrase gene (apy) of enteroinvasive Escherichia coli and Shigella flexneri is under the control of H-NS and the VirF and VirB regulatory cascade. Infect Immun 66, 4957–4964. Bhargava, T., Datta, S., Ramakrishnan, V., Roy, R. K., Sankaran, K. & Subrahmanyam, Y. V. B. K. (1995). Virulent Shigella codes for a
soluble apyrase: identification, characterization and cloning of the gene. Curr Sci 68, 293–300. Bradford, M. M. (1976). A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 72, 248–254. Buchrieser, C., Glaser, P., Rusniok, C., Nedjari, H., d’Hauteville, H., Kunst, F., Sansonetti, P. J. & Parsot, C. (2000). The virulence plasmid
pWR100 and the repertoire of proteins secreted by the type III secretion apparatus of Shigella flexneri. Mol Microbiol 38, 760–771. Cadwell, R. C. & Joyce, G. F. (1992). Randomization of genes by
PCR mutagenesis. PCR Methods Appl 2, 28–33. Cadwell, R. C. & Joyce, G. F. (1994). Mutagenic PCR. PCR Methods
Appl 3, S136–S140. Ishikawa, K., Mihara, Y., Gondoh, K., Suzuki, E. & Asano, Y. (2000).
X-ray structures of a novel acid phosphatase from Escherichia blattae and its complex with the transition-state analog molybdate. EMBO J 19, 2412–2423.
2860
chain-terminating inhibitors. Proc Natl Acad Sci U S A 74, 5463–5467.
Escherichia coli virulence-plasmid-carried apyrase (apy) and ospB genes are organized as a bicistronic operon and are subject to differential expression. Microbiology 148, 2519–2529. Segel, I. H. (1975). Enzyme Kinetics, Behaviour and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems. New York: Wiley. Stukey, J. & Carman, G. M. (1997). Identification of a novel
phosphatase sequence motif. Protein Sci 6, 469–472. Thaller, M. C., Berlutti, F., Schippa, S., Iori, P., Passariello, C. & Rossolini, G. M. (1995). Heterogeneous patterns of acid phosphatases
containing low-molecular-mass polypeptides in members of the family Enterobacteriaceae. Int J Syst Bacteriol 45, 255–261. Thaller, M. C., Berlutti, F., Schippa, S., Selan, L. & Rossolini, G. M. (1998). Bacterial acid phosphatase gene fusions useful as targets
for cloning-dependent insertional inactivation. Biotechnol Prog 14, 241–247. Uchiya, K. I., Tohsuji, M., Nikai, T., Sugihara, H. & Sasakawa, C. (1996). Identification and characterization of phoN-Sf, a gene on
the large plasmid of Shigella flexneri 2a encoding a nonspecific phosphatase. J Bacteriol 178, 4548–4554. Venkatesan, M. M., Goldberg, M. B., Rose, D. J., Grotbeck, E. J., Burland, V. & Blattner, F. R. (2001). Complete DNA sequence and
analysis of the large virulence plasmid of Shigella flexneri. Infect Immun 69, 3271–3285. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13
phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119.
Microbiology 151
