Amyloid Precursor Protein Regulates Brain ... - Semantic Scholar
Neuron, Volume 55
Supplemental Data
Amyloid Precursor Protein Regulates Brain Apolipoprotein E and Cholesterol Metabolism through Lipoprotein Receptor LRP1 Qiang Liu, Celina V. Zerbinatti, Juan Zhang, Hyang-Sook Hoe, Baiping Wang, Sarah L. Cole, Joachim Herz, Louis Muglia, and Guojun Bu Figure S1. Deletion of BACE1 Does Not Affect LRP1 Expression and Function (A and B) LRP1 and LDLR expression was not significantly changed between WT and BACE1-KO MEF cells (A) or between APPsw and APPsw/BACE1-KO MEF cells (B) as detected by Western blot. (C and D) Densitometric analyses of LRP1 and LDLR expression levels from quadruplicate samples. (E and F) LRP1 and LDLR mRNA levels were not changed in BACE1-KO or APPsw/BACE1-KO MEF cells, as detected by real-time PCR. (G-J) 125 I-α2M binding (G and H) and degradation assays (I and J) were performed to compare LRP1 endocytic function between WT and BACE1-KO MEF cells (G and I) or between APPsw and APPsw/BACE1-KO MEF cells (H and J) as described in Figure 2. (K and L) LRP1 expression was not changed in BACE1-KO brain when compared to WT controls (n=3). (M) LRP1 mRNA level was not changed in BACE1-KO brain tissues when compared to WT controls as detected by real-time PCR (n=3).
Figure S2. LRP1 Expression and Function Are Increased in PS1-KO MEF Cells (A) LRP1 and LDLR expression levels were compared between WT and PS1-KO MEF cells by Western blot. (B) Densitometric analyses of Western blots from quadruplicate samples indicate a significantly increase in the expression of LRP1, but not LDLR, in PS1-KO MEF cells. (C) LRP1 mRNA level was increased in PS1-KO MEF cells as detected by real-time PCR. (D and E) 125I-α2M binding (D) and degradation assays (E) were performed to measure LRP1 endocytic capacity as described in Figure 2. α2M binding and degradation were significantly increased in PS1-KO MEF cell.
Figure S3. LRP1 Expression and Function Are Increased in Nicastrin-KO MEF Cells (A) LRP1 and LDLR expression levels were compared between WT and Nicastrin-KO MEF cells by Western blot. (B) Densitometric analyses of Western blots from triplicate samples indicate a significantly increase in the expression of LRP1, but not LDLR, in Nicastrin-KO MEF cells. (C) LRP1 mRNA level was increased in Nicastrin-KO MEF cells as detected by real-time PCR. (D and E) 125I-α2M binding (D) and degradation assays (E) were performed to measure LRP1 endocytic capacity as described in Figure 2. α2M binding and degradation were significantly increased in Nicastrin-KO MEF cells.
Supplementary Methods Western Blot Analysis Cells and brain tissues were lysed on ice in lysis buffer (phosphate-buffered saline containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and protease inhibitor cocktail from Roche). Protein concentrations were determined using a Protein Assay kit (Bio-Rad). Equal amount of protein from each sample was used for SDS– PAGE. The immunoreactive bands were visualized by enhanced chemiluminescence and exposure to film. For densiometric analyses, immunoreactive bands were scanned using a Kodak Digital Science DC120 Zoom camera and quantified using Kodak Digital Science image analysis software.
Ligand Binding and Degradation Assays α2M (20 µg) was iodinated using the IODO-GEN method as described previously (Bu et al., 1993). For ligand binding assays, cells were seeded into 12-well plates such that they were 80% confluent on the day of the experiment. Assay buffer (Dulbecco’s minimal Eagle’s medium containing 0.6% BSA) containing 1 nM 125I-α2M was added to cell monolayers, in the absence or the presence of the LRP antagonist RAP (500 nM), followed by incubation for 1 h at 4°C. Thereafter, overlying buffer containing unbound ligand was removed, and cell monolayers were washed, lysed in 1 M sodium hydroxide and counted. Ligand degradation was measured using the methods as described (Li et al., 2000). Briefly, cells were seeded into 12-well plates 1 day prior to assays. Prewarmed assay buffer containing 1 nM
125
I-α2M was added to cell monolayers, in the absence or presence of
unlabeled 500 nM RAP, followed by incubation for 4 h at 37°C. Thereafter, the medium overlying the cell monolayers was removed and proteins were precipitated by addition of BSA to 10 mg/ml and trichloroacetic acid to 20%. Degradation of radioligand was defined as the appearance of radioactive fragments in the overlying medium that were soluble in 20% trichloroacetic acid. The protein concentration of each cell lysates was measured and used for normalizing ligand degradation efficiency.
Generation of Retrovirus
The vector pBABE (gift from Dr. Sheila Stewart, Washington University) was used to clone AICD C50, AICD C57 and AICD C59. pBABE-AICD C50 was constructed by PCR amplification of the indicated coding sequence of APP from pcDNA3-APP, using the primers: 5’TTTGGTGGAATTCATGATAGCGACAGTGATCGTCATCACC-3’ and 5’TTTACCTCGAGCGTTCTGCATCTGCTCAAAG AAC-3’. The product was digested with EcoRI/BamHI and subcloned into the EcoRI/BamHI site of pBABE. The construct was confirmed by sequencing. pBABE-AICD C57 was constructed using the primers 5’-TTTGGTGGAATTCATGGTGATGCTGAAGAAGAAACAGTAC-3’ and 5’-TTTACCTCGAGCGTTCTGCATCTGCTCAAAGAAC-3’. The amplified product was ligated into the pBABE vector as described above. pBABE-AICD C59 was constructed using the primers 5’TTTGGTGGAATTCATGGTGATGCTGAAGAAGAAACAGTAC-3’ and 5’TTTACCTCGAGCGTTCTGCATCTGCTCAAAGAAC-3’. The amplified product was ligated into the pBABE vector as described above. Retrovirus production was performed as described (Counter et al., 1998).
Supplemental References Counter, C.M., Hahn, W.C., Wei, W., Caddle, S.D., Beijersbergen, R.L., Lansdorp, P.M., Sedivy, J.M., and Weinberg, R.A. (1998). Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc. Natl. Acad. Sci. USA 95, 14723–14728. Li, Y., Marzolo, M.P., Kerkhof, P., Strous, G.J., and Bu, G. (2000). The YXXL motif, but not the two NPXY motifs, serves as the dominant endocytosis signal For LDL receptor-related protein (LRP). J. Biol. Chem. 275, 17187–17194.
Supplemental Data
Amyloid Precursor Protein Regulates Brain Apolipoprotein E and Cholesterol Metabolism through Lipoprotein Receptor LRP1 Qiang Liu, Celina V. Zerbinatti, Juan Zhang, Hyang-Sook Hoe, Baiping Wang, Sarah L. Cole, Joachim Herz, Louis Muglia, and Guojun Bu Figure S1. Deletion of BACE1 Does Not Affect LRP1 Expression and Function (A and B) LRP1 and LDLR expression was not significantly changed between WT and BACE1-KO MEF cells (A) or between APPsw and APPsw/BACE1-KO MEF cells (B) as detected by Western blot. (C and D) Densitometric analyses of LRP1 and LDLR expression levels from quadruplicate samples. (E and F) LRP1 and LDLR mRNA levels were not changed in BACE1-KO or APPsw/BACE1-KO MEF cells, as detected by real-time PCR. (G-J) 125 I-α2M binding (G and H) and degradation assays (I and J) were performed to compare LRP1 endocytic function between WT and BACE1-KO MEF cells (G and I) or between APPsw and APPsw/BACE1-KO MEF cells (H and J) as described in Figure 2. (K and L) LRP1 expression was not changed in BACE1-KO brain when compared to WT controls (n=3). (M) LRP1 mRNA level was not changed in BACE1-KO brain tissues when compared to WT controls as detected by real-time PCR (n=3).
Figure S2. LRP1 Expression and Function Are Increased in PS1-KO MEF Cells (A) LRP1 and LDLR expression levels were compared between WT and PS1-KO MEF cells by Western blot. (B) Densitometric analyses of Western blots from quadruplicate samples indicate a significantly increase in the expression of LRP1, but not LDLR, in PS1-KO MEF cells. (C) LRP1 mRNA level was increased in PS1-KO MEF cells as detected by real-time PCR. (D and E) 125I-α2M binding (D) and degradation assays (E) were performed to measure LRP1 endocytic capacity as described in Figure 2. α2M binding and degradation were significantly increased in PS1-KO MEF cell.
Figure S3. LRP1 Expression and Function Are Increased in Nicastrin-KO MEF Cells (A) LRP1 and LDLR expression levels were compared between WT and Nicastrin-KO MEF cells by Western blot. (B) Densitometric analyses of Western blots from triplicate samples indicate a significantly increase in the expression of LRP1, but not LDLR, in Nicastrin-KO MEF cells. (C) LRP1 mRNA level was increased in Nicastrin-KO MEF cells as detected by real-time PCR. (D and E) 125I-α2M binding (D) and degradation assays (E) were performed to measure LRP1 endocytic capacity as described in Figure 2. α2M binding and degradation were significantly increased in Nicastrin-KO MEF cells.
Supplementary Methods Western Blot Analysis Cells and brain tissues were lysed on ice in lysis buffer (phosphate-buffered saline containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and protease inhibitor cocktail from Roche). Protein concentrations were determined using a Protein Assay kit (Bio-Rad). Equal amount of protein from each sample was used for SDS– PAGE. The immunoreactive bands were visualized by enhanced chemiluminescence and exposure to film. For densiometric analyses, immunoreactive bands were scanned using a Kodak Digital Science DC120 Zoom camera and quantified using Kodak Digital Science image analysis software.
Ligand Binding and Degradation Assays α2M (20 µg) was iodinated using the IODO-GEN method as described previously (Bu et al., 1993). For ligand binding assays, cells were seeded into 12-well plates such that they were 80% confluent on the day of the experiment. Assay buffer (Dulbecco’s minimal Eagle’s medium containing 0.6% BSA) containing 1 nM 125I-α2M was added to cell monolayers, in the absence or the presence of the LRP antagonist RAP (500 nM), followed by incubation for 1 h at 4°C. Thereafter, overlying buffer containing unbound ligand was removed, and cell monolayers were washed, lysed in 1 M sodium hydroxide and counted. Ligand degradation was measured using the methods as described (Li et al., 2000). Briefly, cells were seeded into 12-well plates 1 day prior to assays. Prewarmed assay buffer containing 1 nM
125
I-α2M was added to cell monolayers, in the absence or presence of
unlabeled 500 nM RAP, followed by incubation for 4 h at 37°C. Thereafter, the medium overlying the cell monolayers was removed and proteins were precipitated by addition of BSA to 10 mg/ml and trichloroacetic acid to 20%. Degradation of radioligand was defined as the appearance of radioactive fragments in the overlying medium that were soluble in 20% trichloroacetic acid. The protein concentration of each cell lysates was measured and used for normalizing ligand degradation efficiency.
Generation of Retrovirus
The vector pBABE (gift from Dr. Sheila Stewart, Washington University) was used to clone AICD C50, AICD C57 and AICD C59. pBABE-AICD C50 was constructed by PCR amplification of the indicated coding sequence of APP from pcDNA3-APP, using the primers: 5’TTTGGTGGAATTCATGATAGCGACAGTGATCGTCATCACC-3’ and 5’TTTACCTCGAGCGTTCTGCATCTGCTCAAAG AAC-3’. The product was digested with EcoRI/BamHI and subcloned into the EcoRI/BamHI site of pBABE. The construct was confirmed by sequencing. pBABE-AICD C57 was constructed using the primers 5’-TTTGGTGGAATTCATGGTGATGCTGAAGAAGAAACAGTAC-3’ and 5’-TTTACCTCGAGCGTTCTGCATCTGCTCAAAGAAC-3’. The amplified product was ligated into the pBABE vector as described above. pBABE-AICD C59 was constructed using the primers 5’TTTGGTGGAATTCATGGTGATGCTGAAGAAGAAACAGTAC-3’ and 5’TTTACCTCGAGCGTTCTGCATCTGCTCAAAGAAC-3’. The amplified product was ligated into the pBABE vector as described above. Retrovirus production was performed as described (Counter et al., 1998).
Supplemental References Counter, C.M., Hahn, W.C., Wei, W., Caddle, S.D., Beijersbergen, R.L., Lansdorp, P.M., Sedivy, J.M., and Weinberg, R.A. (1998). Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc. Natl. Acad. Sci. USA 95, 14723–14728. Li, Y., Marzolo, M.P., Kerkhof, P., Strous, G.J., and Bu, G. (2000). The YXXL motif, but not the two NPXY motifs, serves as the dominant endocytosis signal For LDL receptor-related protein (LRP). J. Biol. Chem. 275, 17187–17194.
