Cellulosomes Preparation of Active Recombinant ... - Semantic Scholar
Heterologous Production of Clostridium cellulovorans engB , Using Protease-Deficient Bacillus subtilis, and Preparation of Active Recombinant Cellulosomes
Updated information and services can be found at: http://jb.asm.org/content/184/1/76 These include: REFERENCES
CONTENT ALERTS
This article cites 24 articles, 14 of which can be accessed free at: http://jb.asm.org/content/184/1/76#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
Koichiro Murashima, Chyi-Liang Chen, Akihiko Kosugi, Yutaka Tamaru, Roy H. Doi and Sui-Lam Wong J. Bacteriol. 2002, 184(1):76. DOI: 10.1128/JB.184.1.76-81.2002.
JOURNAL OF BACTERIOLOGY, Jan. 2002, p. 76–81 0021-9193/02/$04.00⫹0 DOI: 10.1128/JB.184.1.76–81.2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Vol. 184, No. 1
Heterologous Production of Clostridium cellulovorans engB, Using Protease-Deficient Bacillus subtilis, and Preparation of Active Recombinant Cellulosomes Koichiro Murashima,1 Chyi-Liang Chen,2 Akihiko Kosugi,1 Yutaka Tamaru,1 Roy H. Doi,1* and Sui-Lam Wong2
Received 21 May 2001/Accepted 25 September 2001
In cellulosomes produced by Clostridium spp., the high-affinity interaction between the dockerin domain and the cohesin domain is responsible for the assembly of enzymatic subunits into the complex. Thus, heterologous expression of full-length enzymatic subunits containing the dockerin domains and of the scaffolding unit is essential for the in vitro assembly of a “designer” cellulosome, or a recombinant cellulosome with a specific function. We report the preparation of Clostridium cellulovorans recombinant cellulosomes containing the enzymatic subunit EngB and the scaffolding unit, mini-CbpA, containing a cellulose binding domain, a putative cell wall binding domain, and two cohesin units. The full-length EngB containing the dockerin domain was expressed by Bacillus subtilis WB800, which is deficient in eight extracellular proteases, to prevent the proteolytic cleavage of the enzymatic subunit between the catalytic and dockerin domains that was observed in previous attempts to express EngB with Escherichia coli. The assembly of recombinant EngB with the miniCbpA was confirmed by immunostaining, a cellulose binding experiment, and native polyacrylamide gel electrophoresis analysis. Clostridium cellulovorans produces a cellulase enzyme complex (cellulosome) containing a variety of cellulolytic subunits attached to the nonenzymatic component termed CbpA (2). All cellulosomal enzymatic subunits contain a twice-repeated sequence, usually at their C termini, called the dockerin domain. These dockerin domains are considered to bind to the hydrophobic domains termed cohesins (19, 26), which are repeated nine times in CbpA (14). So far, we have cloned and sequenced eight cellulosomal cellulase genes from C. cellulovorans (engB [3], engE [16], engH [18], engK [18], engL [15], engM [15], engY [17], and exgS [9]). In addition, the genes for cellulosomal mannanase (manA) (15) and pectate lyase (pelA) (17) have also been cloned and sequenced. In order to understand the hydrolytic mechanism of the cellulosome and to use cellulosomes for industrial purposes, it is very important to make recombinant cellulosomes, or “designer” cellulosomes, with specific functions. To prepare recombinant cellulosomes, it is necessary to express the cellulosomal enzyme subunits that retain their dockerin domains. Escherichia coli is a very efficient host for expression of heterologous genes. However, during the expression of cellulosomal subunits from C. cellulovorans by E. coli, we found that almost all recombinant enzyme proteins were partially degraded between the catalytic and dockerin domains by the proteases of E. coli. Thus, this problem prevented us from preparing recombinant cellulosomes. As a host for heterologous expression, Bacillus subtilis has many attractive features (21). These features include the ability
to secrete extracellular proteins, ease of genetic manipulation, and fast growth. However, one major problem is the presence of high levels of extracellular proteases. Aminov et al. (1) tried to express the celE gene, encoding one of the cellulosomal subunits from Clostridium thermocellum, by use of B. subtilis. Although they used a mutant deficient in two major extracellular proteases, the expressed CelE was truncated by the remaining proteases of B. subtilis. To overcome the problem of degradation by B. subtilis proteases, we have developed B. subtilis strain WB800, which is deficient in eight extracellular proteases, for expression of heterologous genes (25, 27; S.-C. Wu, J. C. Yeung, S. J. Szarka, and S.-L. Wong, presented at the 11th International Conference of Antibody Engineering, San Diego, California, 2000). We used B. subtilis WB800 as an expression host to produce intact EngB, one of the cellulosomal subunits of C. cellulovorans. In addition, a mini-CbpA, which contained a cellulose binding domain (CBD), a putative cell wall binding domain (hydrophilic domain), and two cohesins of CbpA, was constructed and expressed by E. coli. The binding between the recombinant EngB (rEngB) and the mini-CbpA was determined to confirm that the rEngB had a dockerin domain and that a designer minicellulosome had been assembled in vitro. MATERIALS AND METHODS Bacterial strains and media. B. subtilis WB800 (Wu et al., presented at the 11th International Conference of Antibody Engineering) was used as an expression host for EngB production with plasmid pWB980-EngB. Cells carrying the expression plasmid were cultivated in superrich medium (6) containing kanamycin at a final concentration of 10 g/ml. E. coli BL21(DE3) (Novagen) was used as an expression host for mini-CbpA and EngB production using pET-22b-miniCbpA and pET-B2 (4), respectively. Recombinant strains were cultivated in Luria-Bertani medium supplemented with ampicillin (50 g/ml).
* Corresponding author. Mailing address: Section of Molecular and Cellular Biology, University of California, Davis, CA 95616. Phone: (530) 752-3191. Fax: (530) 752-3085. E-mail: [email protected]. 76
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
Section of Molecular and Cellular Biology, University of California, Davis, California 95616,1 and Division of Cellular, Molecular and Microbial Biology, Department of Biological Sciences, University of Calgary, Calgary, Alberta T2N 1N4, Canada2
VOL. 184, 2002
Plasmid construction for mini-CbpA expression by E. coli. The mini-CbpA was designed to consist of a CBD, a hydrophilic domain, and two cohesins of scaffoldin protein CbpA (14) (Fig. 1). For expression of mini-CbpA by E. coli, pET-22b (Novagen) was used as a vector. The mini-CbpA gene was amplified using genomic DNA from C. cellulovorans as a template with a pair of primers, mini-CbpA F (GTATACCATGGCAGCG) and mini-CbpAB (5⬘-GGCTCGAG TATAGGATCTCCAAT). The PCR primers were designed to allow in-frame fusion at the N-terminal end of mini-CbpA with the PelB signal sequence and at the C-terminal end with the His tag from pET-22b. The amplified 1,680-kb fragment had an NcoI site at the 5⬘ end and an XhoI site at the 3⬘ end (Fig. 1). This fragment was digested with NcoI and XhoI and inserted into pET-22b digested with the same pair of the restriction enzymes to generate pET-22bmini-CbpA. Expression and purification of mini-CbpA. E. coli BL21(DE3) harboring pET22b-mini-CbpA was grown in 300 ml of medium at 37°C to an optical density at 600 nm of 0.9. Isopropyl--D-thiogalactoside was then added to a final concentration of 0.4 mM, and the culture was grown at 30°C for 3 h. After collection of E. coli cells by centrifugation, the periplasmic proteins were extracted into 50 ml of extraction buffer (20 mM Tris-HCl [pH 8.0], 10 mM EDTA) by the osmotic shock method (10). A 50-ml aliquot of the supernatant was applied to a CF11 cellulose powder column (Whatman; 20 by 100 mm) and washed with 50 ml of 50 mM sodium phosphate buffer, pH 7.0. The mini-CbpA was then eluted with distilled water. Fractions containing the mini-CbpA were collected, and sodium phosphate buffer (pH 7.0) was added to a final concentration of 50 mM. This solution was applied to an Ni2⫹-nitrilotriacetic acid agarose column (Qiagen; 20 by 150 mm) and washed with 20 ml of 50 mM sodium phosphate buffer (pH 7.0). The mini-CbpA was eluted with 200 mM imidazole in 50 mM sodium phosphate buffer (pH 7.0), and fractions containing the mini-CbpA were collected. Finally, this solution was dialyzed against 50 mM sodium acetate buffer (pH 6.0) and used as the purified mini-CbpA. Plasmid construction for EngB expression by B. subtilis. For production of EngB by B. subtilis WB800, the expression vector pWB980-EngB, which is a derivative of pWB980 (24), was constructed. The engB gene was amplified using plasmid PC2 (3) as a template with a pair of PCR primers, EngB F (5⬘-GGAA GCTTTTGCATCTACAGCTAAGACAGGTATTC) and EngB B (5⬘-GAGCA TGCGTGCTTGGTAATGTATTCAG). The amplified 1.48-kb fragment encoded mature EngB and contained a 247-bp sequence downstream of the engB gene. This fragment has a HindIII site at the 5⬘ end and an SphI site at the 3⬘ end. This design allowed the production of mature EngB with its authentic N-terminal sequence. Since the amplified fragment had an internal HindIII site (861 bp from 5⬘ end), this fragment was inserted into pWB980 by a two-step cloning strategy. The 1.48-kb fragment was first digested with HindIII and XbaI. The resulting 855-bp HindIII-XbaI fragment was inserted into the HindIII-XbaI site of pWB980, and the resulting plasmid was designated pWB980-EngB5. To install the 3⬘ end of engB, the 1.48-kb fragment was digested with XbaI and SphI, and
77
a 625-bp XbaI-SphI fragment was inserted into pWB980-EngB5 to generate pWB980-EngB (Fig. 2). Purification of rEngB expressed by B. subtilis WB800. B. subtilis WB800 (pWB980-EngB) was cultivated in 1,500 ml of superrich medium for 36 h at 30°C. The culture was centrifuged to remove cells. Culture supernatant was collected, precipitated with ammonium sulfate at 40% saturation, and dissolved into 150 ml of 50 mM sodium acetate buffer (pH 6.0). This solution was used as a crude EngB solution. The crude solution was applied to an anti-EngB immunoaffinity column (3-ml bed volume), which was prepared as described previously (12) with the antiserum made against the purified EngB expressed by E. coli. After the column was equilibrated with the first washing buffer (10 mM Tris-HCl [pH 8.0], 0.14 M NaCl, 0.025% NaN3, 0.5% Triton X-100, 0.5% sodium deoxycholate), the crude solution was applied to the column. The column was then washed with 30 ml of the first washing buffer, 30 ml of the second washing buffer (50 mM Tris-HCl [pH 8.0], 0.1% Triton X-100, 0.5 M NaCl), and 30 ml of the third washing buffer (50 mM Tris-HCl [pH 9.0], 0.1% Triton X-100, 0.5 M NaCl). Finally, the bound EngB was eluted with 20 ml of elution buffer (50 mM triethanolamine [pH 11.5], 0.1% Triton X-100, 0.15 M NaCl). The eluted fractions were immediately neutralized with a 20% volume of 1 M Tris-HCl buffer (pH 6.7). This eluted solution was concentrated by use of an Ultrafree 10-kDa membrane (Millipore) and washed with 50 mM Tris-HCl buffer (pH 8.0). This solution was then applied to an Econo-pac HQ anion-exchange column (Bio-Rad) preequilibrated with 50 mM Tris-HCl buffer (pH 8.0). After the column was washed with 5 ml of 150 mM NaCl in 50 mM Tris-HCl buffer (pH 8.0), EngB was eluted with 50 mM Tris-HCl buffer (pH 8.0) containing 300 mM NaCl. Preparation of rEngB by E. coli. E. coli harboring pET-B2 was cultured to obtain rEngB as described previously (4). The periplasmic protein was obtained
FIG. 2. Construction of pWB980-EngB. Plasmid pWB980 carries both the constitutively expressed P43 promoter (20) and the engineered levansucrase signal sequence (22). The engB gene was inserted into pWB980 to generate pWB980-EngB by a two-step cloning strategy as described in Materials and Methods. The sequences coding for the kanamycin resistance marker and levansucrase signal sequence are represented by kan and sacB SP, respectively. The arrows show the transcription directions for the genes.
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
FIG. 1. Schematic diagram of mini-CbpA. The signal sequence, a cellulose binding domain, hydrophilic domains, and cohesin domains of CbpA (14) are shown. Numbers are amino acid residues counted from the translation start of CbpA. The amplified mini-CbpA fragment is also indicated.
HETEROLOGOUS EXPRESSION OF engB BY B. SUBTILIS
78
MURASHIMA ET AL.
RESULTS AND DISCUSSION Expression and purification of recombinant mini-CbpA. The mini-CbpA carried a CBD, a hydrophilic domain, and two cohesin domains (14) with a C-terminal His tag from the vector pET-22b (Fig. 1). The expressed mini-CbpA was secreted to the periplasmic space by means of the pelB signal peptide of the vector pET-22b. Since the mini-CbpA was designed to contain the CBD at its N terminus and the His tag at its C terminus, the nondegraded mini-CbpA was expected to be purified by a combination of cellulose and Ni2⫹ affinity chromatography. After purification of the periplasmic fraction by use of cellulose and Ni2⫹ columns, a homogeneous band was observed by SDS-PAGE analysis (Fig. 3, lane 1). The calculated molecular mass of the mini-CbpA was 58.0 kDa (miniCbpA [57,208 Da] plus six His residues [812 Da]). The apparent molecular mass of this protein was about 58 kDa, which was in good agreement with the calculated molecular mass. This protein was confirmed to be mini-CbpA by immunostaining with antibody against CbpA that was purified from cellulosomes of C. cellulovorans (12) (data not shown). About 2.8 mg of the mini-CbpA could be purified from 1.0 liter of the recombinant E. coli culture. Heterologous expression of EngB by protease-deficient B. subtilis WB800. So far, we have expressed in E. coli the C. cellulovorans cellulosomal subunit genes engB (3), engE (16),
FIG. 3. Silver-stained SDS-polyacrylamide gel showing the purified mini-CbpA (lane 1) and the purified rEngB-B (lane 2).
exgS (9), manA (15), and pelA (17). Although E. coli could express these subunits successfully, the recombinant subunits were partially degraded by E. coli proteases during the culture period and/or the purification procedure. The degradation occurred especially between the catalytic domain and the dockerin domain of the cellulosomal subunits. In this work, B. subtilis was chosen as a host for heterologous expression of cellulosomal subunits in the hope that less degradation would occur. B. subtilis also produces high levels of extracellular proteases during the stationary phase. Thus, it has been shown that heterologous proteins expressed by B. subtilis are rapidly degraded by the extracellular proteases. To overcome this problem, we developed a strain, B. subtilis WB800, deficient in eight extracellular proteases (25, 27; Wu et al., presented at the 11th International Conference of Antibody Engineering). Since the engB gene was the smallest among the cellulosomal cellulase genes of C. cellulovorans (18), we chose engB for expression by B. subtilis WB800. As an expression vector for the engB gene, pWB980-EngB was constructed (Fig. 2). This vector contained the P43 promoter (20), the sacB signal sequence (22), and the kanamycin resistance marker. The P43 promoter is a strong and constitutively expressed promoter and was used to direct the transcription of engB during growth (Fig. 2). The sacB signal sequence allowed the recombinant protein to be secreted into the culture broth. When recombinant B. subtilis WB800 harboring pWB980-EngB was grown at 37°C, most of the rEngB was expressed as inclusion bodies (data not shown). In contrast, when grown at 30°C, the cells secreted most of the rEngB-B into the culture broth. The culture supernatants of B. subtilis WB800(pWB980-EngB) collected at different time points were analyzed by Western blotting with anti-EngB. As shown in Fig. 4A, one stained band appeared at the position of 48 kDa. The molecular mass of this band was in good agreement with the calculated molecular mass of the rEngB-B (48.5 kDa) (3). This band accumulated for up to 30 h of the culture period, and no degradation of the rEngB-B was observed up to 48 h. These results indicated that the rEngB-B secreted into the culture broth was very stable during the culture period. The use of B. subtilis WB800 was essential for the production of intact EngB. Degraded EngB was observed even when B. subtilis WB700, deficient in seven extracellular proteases (27), was used as an expression host (data not shown). This suggests that the cell wall protease WprA (11),
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
by the osmotic shock method (10). The protein from 10 ml of culture broth was concentrated into 1 ml of 20 mM Tris-HCl buffer (pH 8.0). Assay of CMCase activity. Carboxymethylcellulose (medium viscosity; Sigma) degradation activity (CMCase activity) was assayed in 50 mM sodium acetate buffer (pH 6.0) at 37°C by measuring the liberated reducing sugars, as D-glucose equivalents, by the Somogyi-Nelson assay method (23). Activities were expressed as units, with 1 U defined as the amount of enzyme releasing 1 mol of reducing sugar per min. Protein determination. Protein concentrations were measured with the bicinchoninic acid protein assay system (Pierce) using bovine serum albumin as a standard. The molar amounts of mini-CbpA and EngB were calculated by use of the theoretical molecular masses of mini-CbpA (58.0 kDa) and EngB (48.5 kDa). Determination of mini-CbpA binding with rEngB. To test the binding of the mini-CbpA with the rEngB, the purified mini-CbpA (2 g per lane) was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and electroblotted to a polyvinylidene difluoride membrane. The blotted membrane was then immersed in 50 ml of blocking solution (phosphate-buffered saline [137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4], 1% Tween, 1% skim milk) containing 1 ml of the crude EngB expressed by B. subtilis or the EngB found in the periplasmic fraction of E. coli for 1 h at room temperature. After being washed with 1% Tween in phosphate-buffered saline, the membrane was immunostained with anti-EngB. To determine the effect of EDTA on the binding of the rEngB expressed by B. subtilis WB800 (rEngB-B) with the mini-CbpA, 15 mM EDTA was added to the blocking solution with the crude EngB solution from B. subtilis. Determination of cellulose binding of EngB–mini-CbpA complex. To form the EngB–mini-CbpA complex, 2 pmol of purified rEngB-B was mixed with various amounts of purified mini-CbpA in 50 l of binding buffer (100 mM sodium acetate buffer [pH 6.0], 15 mM CaCl2) and incubated at 4°C for 1 h, and then this solution was mixed with 50 l of 2.0% cellulose (Avicel; FMC Corporation) solution and shaken for 1 h at 4°C. After centrifugation, the CMCase activity of the supernatant was assayed as described above. To calculate the percentage of EngB bound to cellulose, the CMCase activity of the supernatant was divided by the activity of the solution without cellulose. Native PAGE analysis of EngB–mini-CbpA complex. To form the EngB–miniCbpA complex, 20 pmol of the purified EngB expressed by B. subtilis WB800 and 20 pmol of the purified mini-CbpA were mixed in 5 l of the binding buffer described above and kept for 1 h at 4°C. This solution was then subjected to native PAGE with a 10% ready-made gel (Bio-Rad). After electrophoresis, the gel was silver stained.
J. BACTERIOL.
VOL. 184, 2002
which is inactivated in B. subtilis WB800, is the protease that directly or indirectly contributes to the degradation of EngB in B. subtilis WB700. The recombinant EngB expressed by E. coli (rEngB-E) showed two bands smaller than those of the rEngB-B, and no band was detected at the position of 48 kDa, which is the calculated molecular mass of rEngB-E (4) (Fig. 4B). These results suggested that the rEngB-E was degraded by E. coli proteases during the cultivation period and/or the extraction procedure. Purification of rEngB-B. As the first purification step, the rEngB-B in the culture supernatant was precipitated with 40% saturation of ammonium sulfate. The precipitated fraction was then applied to an anti-EngB immunoaffinity column, and the bound rEngB-B was eluted with ethanolamine buffer (pH 11.5). After anti-EngB affinity chromatography, the eluted rEngB-B was almost homogeneous, with only small amounts of contaminants. To remove the contaminants, the eluted rEngB-B was applied to an anion-exchange column. After anion-exchange chromatography, the purified rEngB-B showed a sharp band on SDS-PAGE analysis (Fig. 3, lane 2). The molecular mass of the purified rEngB-B was 48 kDa. The specific activity of the purified rEngB-B was 22.2 U/mg of protein (as measured by the CMCase assay). Interaction between mini-CbpA and recombinant EngB. With purified mini-CbpA and rEngB-B on hand, we tested their binding interaction by showing a cross-reaction between the two with anti-EngB. The anti-EngB was determined to be highly specific for EngB and showed no cross-reactions with the mini-CbpA (data not shown). The purified mini-CbpA blotted onto a membrane was soaked with rEngB-B from the culture supernatant or from the periplasmic fraction and probed with anti-EngB. Only the membrane incubated with the rEngB-B showed one band at the mini-CbpA position (Fig. 5A). No band could be detected with the membrane treated with rEngB-E (Fig. 5B). These results suggested that rEngB-B could bind with mini-CbpA and that rEngB-E could not. The addition of 15 mM EDTA inhibited the interaction between
79
rEngB-B and mini-CbpA (data not shown). Pages et al. (13) showed that calcium ion is necessary for the binding between dockerin domains and cohesin domains of C. cellulolyticum and C. thermocellum. Since the dockerin domain sequence of EngB has a putative calcium binding motif (13, 18) which is homologous to the calcium binding loop in the EF-hand motif (7), rEngB-B is also considered to require calcium ion to bind with the cohesin domain of mini-CbpA. Since EngB does not contain a CBD, the purified rEngB-B cannot bind to cellulose. To determine whether rEngB-B mixed with mini-CbpA could attach to cellulose via the CBD of mini-CbpA, a mixture of rEngB-B and mini-CbpA was tested in a cellulose binding experiment. The purified rEngB-B (2.0 pmol) was mixed with various amounts of mini-CbpA, and then the CMCase activity of the rEngB-B bound to cellulose was determined. Since addition of mini-CbpA did not have an effect on the CMCase activity of rEngB-B (data not shown), CMCase activity bound to cellulose was considered to indicate the amount of rEngB-B attached to mini-CbpA. As shown in Fig. 6, CMCase activity bound to cellulose was dependent on the amount of added mini-CbpA. These results indicated that the rEngB-B bound to the mini-CbpA could attach to cellulose via the CBD of mini-CbpA. We previously have characterized the recombinant CBD of CbpA and have shown that 50% of the recombinant CBD added to a cellulose suspension can bind to cellulose (5). If all of the purified rEngB-B could bind with mini-CbpA, about 50% of the rEngB-B would be expected to attach to cellulose. As expected, about 50% of the added rEngB-B (2.0 pmol), which was mixed with more than 1.0 pmol of mini-CbpA, did bind to cellulose. These results suggested that all of the rEngB-B was bound to the miniCbpA. Moreover, although it is very difficult to determine accurate molar amounts of mini-CbpA and rEngB-B, 1.0 pmol
FIG. 5. Interaction between mini-CbpA and rEngB expressed by B. subtilis WB800 (A) and E. coli (B). The mini-CbpA (2 g) was electroblotted onto a polyvinylidene difluoride membrane. The membrane was incubated with crude EngB expressed by B. subtilis (A) or with EngB found in the periplasmic fraction of E. coli (B). Bound proteins were immunostained with anti-EngB.
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
FIG. 4. SDS-PAGE analysis of the culture broth of recombinant B. subtilis WB800 harboring pWB980-EngB (A) and the periplasmic fraction of recombinant E. coli BL21(DE3) harboring pET-B2 (B). The gels were immunostained with anti-EngB. Culture periods in panel A: lane 1, 12 h; lane 2, 18 h; lane 3, 24 h; lane 4, 30 h; lane 5, 36 h; lane 6, 42 h; lane 7, 48 h.
HETEROLOGOUS EXPRESSION OF engB BY B. SUBTILIS
80
MURASHIMA ET AL.
J. BACTERIOL.
ACKNOWLEDGMENTS
FIG. 6. Cellulose binding of rEngB-B mixed with mini-CbpA. rEngB-B (2 pmol) was mixed with various amounts of mini-CbpA, and then the mixtures of rEngB-B and mini-CbpA were bound to 500 g of Avicel. The amounts of rEngB-B bound to Avicel were determined as described in Materials and Methods.
of mini-CbpA is likely to be enough to bind with 2.0 pmol of rEngB-B. To confirm that all of the purified rEngB-B could bind to mini-CbpA, the mixture of rEngB-B and mini-CbpA (molar ratio of 1:1) was analyzed with native PAGE. The results are shown in Fig. 7. Compared with the purified rEngB-B (Fig. 7, lane 1) and the purified mini-CbpA (Fig. 7, lane 3), the mixture of rEngB-B and mini-CbpA showed one new band (Fig. 7, lane 2) and no rEngB-B band. This new band was considered to be the rEngB-B–mini-CbpA complex, and all of the rEngB-B appeared to be bound to the mini-CbpA to form minicellulosomes. Since the mini-CbpA was designed to have two cohesin domains, the mixture could form two types of complexes (one or both cohesin domains of mini-CbpA could be occupied by rEngB-B). However, the mixture of rEngB-B and mini-CbpA showed only one new band in spite of the existence of a free mini-CbpA band. Kataeva et al. (8) showed that the mixture of
FIG. 7. Native PAGE analysis of the rEngB-B–mini-CbpA complex. Lane 1, rEngB-B; lane 2, mixture of rEngB-B and mini-CbpA (molar ratio, 1:1); lane 3, mini-CbpA.
We thank Helen M. Chan and Judy Wu for their excellent technical support and Wilfred de la Cruz for helpful discussions. This research was supported by grant DE-DDF03-92ER20069 from the U.S. Department of Energy and by the Natural Sciences and Engineering Research Council of Canada. REFERENCES 1. Aminov, R. I., N. P. Golovchenko, and K. Ohmiya. 1995. Expression of a celE Gene from Clostridium thermocellum in Bacillus. J. Ferment. Bioeng. 79:530– 537. 2. Doi, R. H., J. S. Park, C. C. Liu, L. M. Malburg, Y. Tamaru, A. Ichiishi, and A. Ibrahim. 1998. Cellulosome and non-cellulosomal cellulases of Clostridium cellulovorans. Extremophiles 2:53–60. 3. Foong, F., T. Hamamoto, O. Shoseyov, and R. H. Doi. 1991. Nucleotide sequence and characteristics of endoglucanase gene engB from Clostridium cellulovorans. J. Gen. Microbiol. 137:1729–1736. 4. Foong, F. C., and R. H. Doi. 1992. Characterization and comparison of Clostridium cellulovorans endoglucanases-xylanases EngB and EngD hyperexpressed in Escherichia coli. J. Bacteriol. 174:1403–1409. 5. Goldstein, M. A., M. Takagi, S. Hashida, O. Shoseyov, R. H. Doi, and I. H. Segel. 1993. Characterization of the cellulose-binding domain of the Clostridium cellulovorans cellulose-binding protein A. J. Bacteriol. 175:5762– 5768. 6. Halling, S. M., F. J. Sanchez-Anzaldo, R. Fukuda, R. H. Doi, and C. F. Meares. 1977. Zinc is associated with the beta subunit of DNA dependent RNA polymerase of Bacillus subtilis. Biochemistry 16:2880–2884. 7. Herzberg, O., and M. N. James. 1988. Refined crystal structure of troponin C from turkey skeletal muscle at 2.0 Angstrom resolution. J. Mol. Biol. 203:761–779. 8. Kataeva, I., G. Guglielmi, and P. Beguin. 1997. Interaction between Clostridium thermocellum endoglucanase CelD and polypeptides derived from the cellulosome-integrating protein CipA: stoichiometry and cellulolytic activity of the complex. Biochem. J. 326:617–624. 9. Liu, C. C., and R. H. Doi. 1998. Properties of exgS, a gene for a major subunit of the Clostridium cellulovorans cellulosome. Gene 211:39–47. 10. Manoil, C., and J. Beckwith. 1986. A genomic approach to analyzing membrane protein topology. Science 233:1403–1408. 11. Margot, P., and D. Karamata. 1996. The wprA gene of Bacillus subtilis 168, expressed during exponential growth, encodes a cell-wall-associated protease. Microbiology 142:3437–3444. 12. Matano, Y., J. S. Park, M. A. Goldstein, and R. H. Doi. 1994. Cellulose promotes extracellular assembly of Clostridium cellulovorans cellulosomes. J. Bacteriol. 176:6952–6956. 13. Pages, S., A. Belaich, J. P. Belaich, E. Morag, R. Lamed, Y. Shoham, and E. A. Bayer. 1997. Species-specificity of the cohesin-dockerin interaction between Clostridium thermocellum and Clostridium cellulolyticum: prediction of specificity determinants of the dockerin domain. Proteins 29:517–527. 14. Shoseyov, O., M. Takagi, M. A. Goldstein, and R. H. Doi. 1992. Primary sequence analysis of Clostridium cellulovorans cellulose binding protein A. Proc. Natl. Acad. Sci. USA 89:3483–3487. 15. Tamaru, Y., and R. H. Doi. 2000. The engL gene cluster of Clostridium cellulovorans contains a gene for cellulosomal manA. J. Bacteriol. 182:244– 247. 16. Tamaru, Y., and R. H. Doi. 1999. Three surface layer homology domains at
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
cellulosomal cellulase CelD and Cip16 containing two cohesin domains from C. thermocellum formed only one type of complex even if an excess amount of Cip16 was present. By use of sedimentation equilibrium analysis, they concluded that both cohesin domains of the complex were occupied by the CelDs. Based on this observation, the mixture of mini-CbpA and rEngB-B may have formed only complexes in which both cohesin domains were occupied. We have shown that an intact C. cellulovorans EngB endoglucanase can be produced by B. subtilis WB800, that rEngB-B can interact with a mini-CbpA produced by E. coli, and that the rEngB-B–mini-CbpA complex can bind to cellulose. This is a first step that we hope will lead to the production of a variety of designer cellulosomes. In future experiments we hope to express the C. cellulovorans-derived mini-CbpAs and cellulosomal enzymes in B. subtilis and create designer cellulosomes in vivo.
VOL. 184, 2002
17. 18. 19. 20. 21.
81
23. Wood, W. A., and K. M. Bhat. 1988. Method for measuring cellulase activities. Methods Enzymol. 160:87–112. 24. Wu, S.-C., and S.-L. Wong. 1999. Development of improved pUB110-based vectors for expression and secretion studies in Bacillus subtilis. J. Biotechnol. 72:188–195. 25. Wu, X. C., W. Lee, L. Tran, and S. L. Wong. 1991. Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases. J. Bacteriol. 173:4952–4958. 26. Yaron, S., E. Morag, E. A. Bayer, R. Lamed, and Y. Shoham. 1995. Expression, purification and subunit-binding properties of cohesins 2 and 3 of the Clostridium thermocellum cellulosome. FEBS Lett. 360:121–124. 27. Ye, R., L. P. Yang, and S.-L. Wong. 1996. Construction of protease deficient Bacillus subtilis strains for expression studies: inactivation of seven extracellular protease and the intracellular LonA protease, p. 160–169. In S. K. Hong and W. J. Lim (ed.), Proceedings of the International Symposium on Recent Advances in Bioindustry. The Korean Society for Applied Microbiology, Seoul, Korea.
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
22.
the N terminus of the Clostridium cellulovorans major cellulosomal subunit EngE. J. Bacteriol. 181:3270–3276. Tamaru, Y., and R. H. Doi. 2001. Pectate lyase A, an enzymatic subunit of the Clostridium cellulovorans cellulosome. Proc. Natl. Acad. Sci. USA 98: 4125–4129. Tamaru, Y., S. Karita, A. Ibrahim, H. Chan, and R. H. Doi. 2000. A large gene cluster for the Clostridium cellulovorans cellulosome. J. Bacteriol. 182: 5906–5910. Tokatlidis, K., P. Dhurjati, and P. Beguin. 1993. Properties conferred on Clostridium thermocellum endoglucanase CelC by grafting the duplicated segment of endoglucanase CelD. Prot. Eng. 6:947–952. Wang, P.-Z., and R. H. Doi. 1984. Overlapping promoters transcribed by Bacillus subtilis 55 and 37 RNA polymerase holoenzymes during growth and stationary phase. J. Biol. Chem. 259:8619–8625. Wong, S. L. 1995. Advances in the use of Bacillus subtilis for the expression and secretion of heterologous proteins. Curr. Opin. Biotechnol. 6:517–522. Wong, S. L. 1989. Development of an inducible and enhancible expression and secretion system in Bacillus subtilis. Gene 83:215–223.
HETEROLOGOUS EXPRESSION OF engB BY B. SUBTILIS
Updated information and services can be found at: http://jb.asm.org/content/184/1/76 These include: REFERENCES
CONTENT ALERTS
This article cites 24 articles, 14 of which can be accessed free at: http://jb.asm.org/content/184/1/76#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
Koichiro Murashima, Chyi-Liang Chen, Akihiko Kosugi, Yutaka Tamaru, Roy H. Doi and Sui-Lam Wong J. Bacteriol. 2002, 184(1):76. DOI: 10.1128/JB.184.1.76-81.2002.
JOURNAL OF BACTERIOLOGY, Jan. 2002, p. 76–81 0021-9193/02/$04.00⫹0 DOI: 10.1128/JB.184.1.76–81.2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Vol. 184, No. 1
Heterologous Production of Clostridium cellulovorans engB, Using Protease-Deficient Bacillus subtilis, and Preparation of Active Recombinant Cellulosomes Koichiro Murashima,1 Chyi-Liang Chen,2 Akihiko Kosugi,1 Yutaka Tamaru,1 Roy H. Doi,1* and Sui-Lam Wong2
Received 21 May 2001/Accepted 25 September 2001
In cellulosomes produced by Clostridium spp., the high-affinity interaction between the dockerin domain and the cohesin domain is responsible for the assembly of enzymatic subunits into the complex. Thus, heterologous expression of full-length enzymatic subunits containing the dockerin domains and of the scaffolding unit is essential for the in vitro assembly of a “designer” cellulosome, or a recombinant cellulosome with a specific function. We report the preparation of Clostridium cellulovorans recombinant cellulosomes containing the enzymatic subunit EngB and the scaffolding unit, mini-CbpA, containing a cellulose binding domain, a putative cell wall binding domain, and two cohesin units. The full-length EngB containing the dockerin domain was expressed by Bacillus subtilis WB800, which is deficient in eight extracellular proteases, to prevent the proteolytic cleavage of the enzymatic subunit between the catalytic and dockerin domains that was observed in previous attempts to express EngB with Escherichia coli. The assembly of recombinant EngB with the miniCbpA was confirmed by immunostaining, a cellulose binding experiment, and native polyacrylamide gel electrophoresis analysis. Clostridium cellulovorans produces a cellulase enzyme complex (cellulosome) containing a variety of cellulolytic subunits attached to the nonenzymatic component termed CbpA (2). All cellulosomal enzymatic subunits contain a twice-repeated sequence, usually at their C termini, called the dockerin domain. These dockerin domains are considered to bind to the hydrophobic domains termed cohesins (19, 26), which are repeated nine times in CbpA (14). So far, we have cloned and sequenced eight cellulosomal cellulase genes from C. cellulovorans (engB [3], engE [16], engH [18], engK [18], engL [15], engM [15], engY [17], and exgS [9]). In addition, the genes for cellulosomal mannanase (manA) (15) and pectate lyase (pelA) (17) have also been cloned and sequenced. In order to understand the hydrolytic mechanism of the cellulosome and to use cellulosomes for industrial purposes, it is very important to make recombinant cellulosomes, or “designer” cellulosomes, with specific functions. To prepare recombinant cellulosomes, it is necessary to express the cellulosomal enzyme subunits that retain their dockerin domains. Escherichia coli is a very efficient host for expression of heterologous genes. However, during the expression of cellulosomal subunits from C. cellulovorans by E. coli, we found that almost all recombinant enzyme proteins were partially degraded between the catalytic and dockerin domains by the proteases of E. coli. Thus, this problem prevented us from preparing recombinant cellulosomes. As a host for heterologous expression, Bacillus subtilis has many attractive features (21). These features include the ability
to secrete extracellular proteins, ease of genetic manipulation, and fast growth. However, one major problem is the presence of high levels of extracellular proteases. Aminov et al. (1) tried to express the celE gene, encoding one of the cellulosomal subunits from Clostridium thermocellum, by use of B. subtilis. Although they used a mutant deficient in two major extracellular proteases, the expressed CelE was truncated by the remaining proteases of B. subtilis. To overcome the problem of degradation by B. subtilis proteases, we have developed B. subtilis strain WB800, which is deficient in eight extracellular proteases, for expression of heterologous genes (25, 27; S.-C. Wu, J. C. Yeung, S. J. Szarka, and S.-L. Wong, presented at the 11th International Conference of Antibody Engineering, San Diego, California, 2000). We used B. subtilis WB800 as an expression host to produce intact EngB, one of the cellulosomal subunits of C. cellulovorans. In addition, a mini-CbpA, which contained a cellulose binding domain (CBD), a putative cell wall binding domain (hydrophilic domain), and two cohesins of CbpA, was constructed and expressed by E. coli. The binding between the recombinant EngB (rEngB) and the mini-CbpA was determined to confirm that the rEngB had a dockerin domain and that a designer minicellulosome had been assembled in vitro. MATERIALS AND METHODS Bacterial strains and media. B. subtilis WB800 (Wu et al., presented at the 11th International Conference of Antibody Engineering) was used as an expression host for EngB production with plasmid pWB980-EngB. Cells carrying the expression plasmid were cultivated in superrich medium (6) containing kanamycin at a final concentration of 10 g/ml. E. coli BL21(DE3) (Novagen) was used as an expression host for mini-CbpA and EngB production using pET-22b-miniCbpA and pET-B2 (4), respectively. Recombinant strains were cultivated in Luria-Bertani medium supplemented with ampicillin (50 g/ml).
* Corresponding author. Mailing address: Section of Molecular and Cellular Biology, University of California, Davis, CA 95616. Phone: (530) 752-3191. Fax: (530) 752-3085. E-mail: [email protected]. 76
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
Section of Molecular and Cellular Biology, University of California, Davis, California 95616,1 and Division of Cellular, Molecular and Microbial Biology, Department of Biological Sciences, University of Calgary, Calgary, Alberta T2N 1N4, Canada2
VOL. 184, 2002
Plasmid construction for mini-CbpA expression by E. coli. The mini-CbpA was designed to consist of a CBD, a hydrophilic domain, and two cohesins of scaffoldin protein CbpA (14) (Fig. 1). For expression of mini-CbpA by E. coli, pET-22b (Novagen) was used as a vector. The mini-CbpA gene was amplified using genomic DNA from C. cellulovorans as a template with a pair of primers, mini-CbpA F (GTATACCATGGCAGCG) and mini-CbpAB (5⬘-GGCTCGAG TATAGGATCTCCAAT). The PCR primers were designed to allow in-frame fusion at the N-terminal end of mini-CbpA with the PelB signal sequence and at the C-terminal end with the His tag from pET-22b. The amplified 1,680-kb fragment had an NcoI site at the 5⬘ end and an XhoI site at the 3⬘ end (Fig. 1). This fragment was digested with NcoI and XhoI and inserted into pET-22b digested with the same pair of the restriction enzymes to generate pET-22bmini-CbpA. Expression and purification of mini-CbpA. E. coli BL21(DE3) harboring pET22b-mini-CbpA was grown in 300 ml of medium at 37°C to an optical density at 600 nm of 0.9. Isopropyl--D-thiogalactoside was then added to a final concentration of 0.4 mM, and the culture was grown at 30°C for 3 h. After collection of E. coli cells by centrifugation, the periplasmic proteins were extracted into 50 ml of extraction buffer (20 mM Tris-HCl [pH 8.0], 10 mM EDTA) by the osmotic shock method (10). A 50-ml aliquot of the supernatant was applied to a CF11 cellulose powder column (Whatman; 20 by 100 mm) and washed with 50 ml of 50 mM sodium phosphate buffer, pH 7.0. The mini-CbpA was then eluted with distilled water. Fractions containing the mini-CbpA were collected, and sodium phosphate buffer (pH 7.0) was added to a final concentration of 50 mM. This solution was applied to an Ni2⫹-nitrilotriacetic acid agarose column (Qiagen; 20 by 150 mm) and washed with 20 ml of 50 mM sodium phosphate buffer (pH 7.0). The mini-CbpA was eluted with 200 mM imidazole in 50 mM sodium phosphate buffer (pH 7.0), and fractions containing the mini-CbpA were collected. Finally, this solution was dialyzed against 50 mM sodium acetate buffer (pH 6.0) and used as the purified mini-CbpA. Plasmid construction for EngB expression by B. subtilis. For production of EngB by B. subtilis WB800, the expression vector pWB980-EngB, which is a derivative of pWB980 (24), was constructed. The engB gene was amplified using plasmid PC2 (3) as a template with a pair of PCR primers, EngB F (5⬘-GGAA GCTTTTGCATCTACAGCTAAGACAGGTATTC) and EngB B (5⬘-GAGCA TGCGTGCTTGGTAATGTATTCAG). The amplified 1.48-kb fragment encoded mature EngB and contained a 247-bp sequence downstream of the engB gene. This fragment has a HindIII site at the 5⬘ end and an SphI site at the 3⬘ end. This design allowed the production of mature EngB with its authentic N-terminal sequence. Since the amplified fragment had an internal HindIII site (861 bp from 5⬘ end), this fragment was inserted into pWB980 by a two-step cloning strategy. The 1.48-kb fragment was first digested with HindIII and XbaI. The resulting 855-bp HindIII-XbaI fragment was inserted into the HindIII-XbaI site of pWB980, and the resulting plasmid was designated pWB980-EngB5. To install the 3⬘ end of engB, the 1.48-kb fragment was digested with XbaI and SphI, and
77
a 625-bp XbaI-SphI fragment was inserted into pWB980-EngB5 to generate pWB980-EngB (Fig. 2). Purification of rEngB expressed by B. subtilis WB800. B. subtilis WB800 (pWB980-EngB) was cultivated in 1,500 ml of superrich medium for 36 h at 30°C. The culture was centrifuged to remove cells. Culture supernatant was collected, precipitated with ammonium sulfate at 40% saturation, and dissolved into 150 ml of 50 mM sodium acetate buffer (pH 6.0). This solution was used as a crude EngB solution. The crude solution was applied to an anti-EngB immunoaffinity column (3-ml bed volume), which was prepared as described previously (12) with the antiserum made against the purified EngB expressed by E. coli. After the column was equilibrated with the first washing buffer (10 mM Tris-HCl [pH 8.0], 0.14 M NaCl, 0.025% NaN3, 0.5% Triton X-100, 0.5% sodium deoxycholate), the crude solution was applied to the column. The column was then washed with 30 ml of the first washing buffer, 30 ml of the second washing buffer (50 mM Tris-HCl [pH 8.0], 0.1% Triton X-100, 0.5 M NaCl), and 30 ml of the third washing buffer (50 mM Tris-HCl [pH 9.0], 0.1% Triton X-100, 0.5 M NaCl). Finally, the bound EngB was eluted with 20 ml of elution buffer (50 mM triethanolamine [pH 11.5], 0.1% Triton X-100, 0.15 M NaCl). The eluted fractions were immediately neutralized with a 20% volume of 1 M Tris-HCl buffer (pH 6.7). This eluted solution was concentrated by use of an Ultrafree 10-kDa membrane (Millipore) and washed with 50 mM Tris-HCl buffer (pH 8.0). This solution was then applied to an Econo-pac HQ anion-exchange column (Bio-Rad) preequilibrated with 50 mM Tris-HCl buffer (pH 8.0). After the column was washed with 5 ml of 150 mM NaCl in 50 mM Tris-HCl buffer (pH 8.0), EngB was eluted with 50 mM Tris-HCl buffer (pH 8.0) containing 300 mM NaCl. Preparation of rEngB by E. coli. E. coli harboring pET-B2 was cultured to obtain rEngB as described previously (4). The periplasmic protein was obtained
FIG. 2. Construction of pWB980-EngB. Plasmid pWB980 carries both the constitutively expressed P43 promoter (20) and the engineered levansucrase signal sequence (22). The engB gene was inserted into pWB980 to generate pWB980-EngB by a two-step cloning strategy as described in Materials and Methods. The sequences coding for the kanamycin resistance marker and levansucrase signal sequence are represented by kan and sacB SP, respectively. The arrows show the transcription directions for the genes.
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
FIG. 1. Schematic diagram of mini-CbpA. The signal sequence, a cellulose binding domain, hydrophilic domains, and cohesin domains of CbpA (14) are shown. Numbers are amino acid residues counted from the translation start of CbpA. The amplified mini-CbpA fragment is also indicated.
HETEROLOGOUS EXPRESSION OF engB BY B. SUBTILIS
78
MURASHIMA ET AL.
RESULTS AND DISCUSSION Expression and purification of recombinant mini-CbpA. The mini-CbpA carried a CBD, a hydrophilic domain, and two cohesin domains (14) with a C-terminal His tag from the vector pET-22b (Fig. 1). The expressed mini-CbpA was secreted to the periplasmic space by means of the pelB signal peptide of the vector pET-22b. Since the mini-CbpA was designed to contain the CBD at its N terminus and the His tag at its C terminus, the nondegraded mini-CbpA was expected to be purified by a combination of cellulose and Ni2⫹ affinity chromatography. After purification of the periplasmic fraction by use of cellulose and Ni2⫹ columns, a homogeneous band was observed by SDS-PAGE analysis (Fig. 3, lane 1). The calculated molecular mass of the mini-CbpA was 58.0 kDa (miniCbpA [57,208 Da] plus six His residues [812 Da]). The apparent molecular mass of this protein was about 58 kDa, which was in good agreement with the calculated molecular mass. This protein was confirmed to be mini-CbpA by immunostaining with antibody against CbpA that was purified from cellulosomes of C. cellulovorans (12) (data not shown). About 2.8 mg of the mini-CbpA could be purified from 1.0 liter of the recombinant E. coli culture. Heterologous expression of EngB by protease-deficient B. subtilis WB800. So far, we have expressed in E. coli the C. cellulovorans cellulosomal subunit genes engB (3), engE (16),
FIG. 3. Silver-stained SDS-polyacrylamide gel showing the purified mini-CbpA (lane 1) and the purified rEngB-B (lane 2).
exgS (9), manA (15), and pelA (17). Although E. coli could express these subunits successfully, the recombinant subunits were partially degraded by E. coli proteases during the culture period and/or the purification procedure. The degradation occurred especially between the catalytic domain and the dockerin domain of the cellulosomal subunits. In this work, B. subtilis was chosen as a host for heterologous expression of cellulosomal subunits in the hope that less degradation would occur. B. subtilis also produces high levels of extracellular proteases during the stationary phase. Thus, it has been shown that heterologous proteins expressed by B. subtilis are rapidly degraded by the extracellular proteases. To overcome this problem, we developed a strain, B. subtilis WB800, deficient in eight extracellular proteases (25, 27; Wu et al., presented at the 11th International Conference of Antibody Engineering). Since the engB gene was the smallest among the cellulosomal cellulase genes of C. cellulovorans (18), we chose engB for expression by B. subtilis WB800. As an expression vector for the engB gene, pWB980-EngB was constructed (Fig. 2). This vector contained the P43 promoter (20), the sacB signal sequence (22), and the kanamycin resistance marker. The P43 promoter is a strong and constitutively expressed promoter and was used to direct the transcription of engB during growth (Fig. 2). The sacB signal sequence allowed the recombinant protein to be secreted into the culture broth. When recombinant B. subtilis WB800 harboring pWB980-EngB was grown at 37°C, most of the rEngB was expressed as inclusion bodies (data not shown). In contrast, when grown at 30°C, the cells secreted most of the rEngB-B into the culture broth. The culture supernatants of B. subtilis WB800(pWB980-EngB) collected at different time points were analyzed by Western blotting with anti-EngB. As shown in Fig. 4A, one stained band appeared at the position of 48 kDa. The molecular mass of this band was in good agreement with the calculated molecular mass of the rEngB-B (48.5 kDa) (3). This band accumulated for up to 30 h of the culture period, and no degradation of the rEngB-B was observed up to 48 h. These results indicated that the rEngB-B secreted into the culture broth was very stable during the culture period. The use of B. subtilis WB800 was essential for the production of intact EngB. Degraded EngB was observed even when B. subtilis WB700, deficient in seven extracellular proteases (27), was used as an expression host (data not shown). This suggests that the cell wall protease WprA (11),
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
by the osmotic shock method (10). The protein from 10 ml of culture broth was concentrated into 1 ml of 20 mM Tris-HCl buffer (pH 8.0). Assay of CMCase activity. Carboxymethylcellulose (medium viscosity; Sigma) degradation activity (CMCase activity) was assayed in 50 mM sodium acetate buffer (pH 6.0) at 37°C by measuring the liberated reducing sugars, as D-glucose equivalents, by the Somogyi-Nelson assay method (23). Activities were expressed as units, with 1 U defined as the amount of enzyme releasing 1 mol of reducing sugar per min. Protein determination. Protein concentrations were measured with the bicinchoninic acid protein assay system (Pierce) using bovine serum albumin as a standard. The molar amounts of mini-CbpA and EngB were calculated by use of the theoretical molecular masses of mini-CbpA (58.0 kDa) and EngB (48.5 kDa). Determination of mini-CbpA binding with rEngB. To test the binding of the mini-CbpA with the rEngB, the purified mini-CbpA (2 g per lane) was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and electroblotted to a polyvinylidene difluoride membrane. The blotted membrane was then immersed in 50 ml of blocking solution (phosphate-buffered saline [137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4], 1% Tween, 1% skim milk) containing 1 ml of the crude EngB expressed by B. subtilis or the EngB found in the periplasmic fraction of E. coli for 1 h at room temperature. After being washed with 1% Tween in phosphate-buffered saline, the membrane was immunostained with anti-EngB. To determine the effect of EDTA on the binding of the rEngB expressed by B. subtilis WB800 (rEngB-B) with the mini-CbpA, 15 mM EDTA was added to the blocking solution with the crude EngB solution from B. subtilis. Determination of cellulose binding of EngB–mini-CbpA complex. To form the EngB–mini-CbpA complex, 2 pmol of purified rEngB-B was mixed with various amounts of purified mini-CbpA in 50 l of binding buffer (100 mM sodium acetate buffer [pH 6.0], 15 mM CaCl2) and incubated at 4°C for 1 h, and then this solution was mixed with 50 l of 2.0% cellulose (Avicel; FMC Corporation) solution and shaken for 1 h at 4°C. After centrifugation, the CMCase activity of the supernatant was assayed as described above. To calculate the percentage of EngB bound to cellulose, the CMCase activity of the supernatant was divided by the activity of the solution without cellulose. Native PAGE analysis of EngB–mini-CbpA complex. To form the EngB–miniCbpA complex, 20 pmol of the purified EngB expressed by B. subtilis WB800 and 20 pmol of the purified mini-CbpA were mixed in 5 l of the binding buffer described above and kept for 1 h at 4°C. This solution was then subjected to native PAGE with a 10% ready-made gel (Bio-Rad). After electrophoresis, the gel was silver stained.
J. BACTERIOL.
VOL. 184, 2002
which is inactivated in B. subtilis WB800, is the protease that directly or indirectly contributes to the degradation of EngB in B. subtilis WB700. The recombinant EngB expressed by E. coli (rEngB-E) showed two bands smaller than those of the rEngB-B, and no band was detected at the position of 48 kDa, which is the calculated molecular mass of rEngB-E (4) (Fig. 4B). These results suggested that the rEngB-E was degraded by E. coli proteases during the cultivation period and/or the extraction procedure. Purification of rEngB-B. As the first purification step, the rEngB-B in the culture supernatant was precipitated with 40% saturation of ammonium sulfate. The precipitated fraction was then applied to an anti-EngB immunoaffinity column, and the bound rEngB-B was eluted with ethanolamine buffer (pH 11.5). After anti-EngB affinity chromatography, the eluted rEngB-B was almost homogeneous, with only small amounts of contaminants. To remove the contaminants, the eluted rEngB-B was applied to an anion-exchange column. After anion-exchange chromatography, the purified rEngB-B showed a sharp band on SDS-PAGE analysis (Fig. 3, lane 2). The molecular mass of the purified rEngB-B was 48 kDa. The specific activity of the purified rEngB-B was 22.2 U/mg of protein (as measured by the CMCase assay). Interaction between mini-CbpA and recombinant EngB. With purified mini-CbpA and rEngB-B on hand, we tested their binding interaction by showing a cross-reaction between the two with anti-EngB. The anti-EngB was determined to be highly specific for EngB and showed no cross-reactions with the mini-CbpA (data not shown). The purified mini-CbpA blotted onto a membrane was soaked with rEngB-B from the culture supernatant or from the periplasmic fraction and probed with anti-EngB. Only the membrane incubated with the rEngB-B showed one band at the mini-CbpA position (Fig. 5A). No band could be detected with the membrane treated with rEngB-E (Fig. 5B). These results suggested that rEngB-B could bind with mini-CbpA and that rEngB-E could not. The addition of 15 mM EDTA inhibited the interaction between
79
rEngB-B and mini-CbpA (data not shown). Pages et al. (13) showed that calcium ion is necessary for the binding between dockerin domains and cohesin domains of C. cellulolyticum and C. thermocellum. Since the dockerin domain sequence of EngB has a putative calcium binding motif (13, 18) which is homologous to the calcium binding loop in the EF-hand motif (7), rEngB-B is also considered to require calcium ion to bind with the cohesin domain of mini-CbpA. Since EngB does not contain a CBD, the purified rEngB-B cannot bind to cellulose. To determine whether rEngB-B mixed with mini-CbpA could attach to cellulose via the CBD of mini-CbpA, a mixture of rEngB-B and mini-CbpA was tested in a cellulose binding experiment. The purified rEngB-B (2.0 pmol) was mixed with various amounts of mini-CbpA, and then the CMCase activity of the rEngB-B bound to cellulose was determined. Since addition of mini-CbpA did not have an effect on the CMCase activity of rEngB-B (data not shown), CMCase activity bound to cellulose was considered to indicate the amount of rEngB-B attached to mini-CbpA. As shown in Fig. 6, CMCase activity bound to cellulose was dependent on the amount of added mini-CbpA. These results indicated that the rEngB-B bound to the mini-CbpA could attach to cellulose via the CBD of mini-CbpA. We previously have characterized the recombinant CBD of CbpA and have shown that 50% of the recombinant CBD added to a cellulose suspension can bind to cellulose (5). If all of the purified rEngB-B could bind with mini-CbpA, about 50% of the rEngB-B would be expected to attach to cellulose. As expected, about 50% of the added rEngB-B (2.0 pmol), which was mixed with more than 1.0 pmol of mini-CbpA, did bind to cellulose. These results suggested that all of the rEngB-B was bound to the miniCbpA. Moreover, although it is very difficult to determine accurate molar amounts of mini-CbpA and rEngB-B, 1.0 pmol
FIG. 5. Interaction between mini-CbpA and rEngB expressed by B. subtilis WB800 (A) and E. coli (B). The mini-CbpA (2 g) was electroblotted onto a polyvinylidene difluoride membrane. The membrane was incubated with crude EngB expressed by B. subtilis (A) or with EngB found in the periplasmic fraction of E. coli (B). Bound proteins were immunostained with anti-EngB.
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
FIG. 4. SDS-PAGE analysis of the culture broth of recombinant B. subtilis WB800 harboring pWB980-EngB (A) and the periplasmic fraction of recombinant E. coli BL21(DE3) harboring pET-B2 (B). The gels were immunostained with anti-EngB. Culture periods in panel A: lane 1, 12 h; lane 2, 18 h; lane 3, 24 h; lane 4, 30 h; lane 5, 36 h; lane 6, 42 h; lane 7, 48 h.
HETEROLOGOUS EXPRESSION OF engB BY B. SUBTILIS
80
MURASHIMA ET AL.
J. BACTERIOL.
ACKNOWLEDGMENTS
FIG. 6. Cellulose binding of rEngB-B mixed with mini-CbpA. rEngB-B (2 pmol) was mixed with various amounts of mini-CbpA, and then the mixtures of rEngB-B and mini-CbpA were bound to 500 g of Avicel. The amounts of rEngB-B bound to Avicel were determined as described in Materials and Methods.
of mini-CbpA is likely to be enough to bind with 2.0 pmol of rEngB-B. To confirm that all of the purified rEngB-B could bind to mini-CbpA, the mixture of rEngB-B and mini-CbpA (molar ratio of 1:1) was analyzed with native PAGE. The results are shown in Fig. 7. Compared with the purified rEngB-B (Fig. 7, lane 1) and the purified mini-CbpA (Fig. 7, lane 3), the mixture of rEngB-B and mini-CbpA showed one new band (Fig. 7, lane 2) and no rEngB-B band. This new band was considered to be the rEngB-B–mini-CbpA complex, and all of the rEngB-B appeared to be bound to the mini-CbpA to form minicellulosomes. Since the mini-CbpA was designed to have two cohesin domains, the mixture could form two types of complexes (one or both cohesin domains of mini-CbpA could be occupied by rEngB-B). However, the mixture of rEngB-B and mini-CbpA showed only one new band in spite of the existence of a free mini-CbpA band. Kataeva et al. (8) showed that the mixture of
FIG. 7. Native PAGE analysis of the rEngB-B–mini-CbpA complex. Lane 1, rEngB-B; lane 2, mixture of rEngB-B and mini-CbpA (molar ratio, 1:1); lane 3, mini-CbpA.
We thank Helen M. Chan and Judy Wu for their excellent technical support and Wilfred de la Cruz for helpful discussions. This research was supported by grant DE-DDF03-92ER20069 from the U.S. Department of Energy and by the Natural Sciences and Engineering Research Council of Canada. REFERENCES 1. Aminov, R. I., N. P. Golovchenko, and K. Ohmiya. 1995. Expression of a celE Gene from Clostridium thermocellum in Bacillus. J. Ferment. Bioeng. 79:530– 537. 2. Doi, R. H., J. S. Park, C. C. Liu, L. M. Malburg, Y. Tamaru, A. Ichiishi, and A. Ibrahim. 1998. Cellulosome and non-cellulosomal cellulases of Clostridium cellulovorans. Extremophiles 2:53–60. 3. Foong, F., T. Hamamoto, O. Shoseyov, and R. H. Doi. 1991. Nucleotide sequence and characteristics of endoglucanase gene engB from Clostridium cellulovorans. J. Gen. Microbiol. 137:1729–1736. 4. Foong, F. C., and R. H. Doi. 1992. Characterization and comparison of Clostridium cellulovorans endoglucanases-xylanases EngB and EngD hyperexpressed in Escherichia coli. J. Bacteriol. 174:1403–1409. 5. Goldstein, M. A., M. Takagi, S. Hashida, O. Shoseyov, R. H. Doi, and I. H. Segel. 1993. Characterization of the cellulose-binding domain of the Clostridium cellulovorans cellulose-binding protein A. J. Bacteriol. 175:5762– 5768. 6. Halling, S. M., F. J. Sanchez-Anzaldo, R. Fukuda, R. H. Doi, and C. F. Meares. 1977. Zinc is associated with the beta subunit of DNA dependent RNA polymerase of Bacillus subtilis. Biochemistry 16:2880–2884. 7. Herzberg, O., and M. N. James. 1988. Refined crystal structure of troponin C from turkey skeletal muscle at 2.0 Angstrom resolution. J. Mol. Biol. 203:761–779. 8. Kataeva, I., G. Guglielmi, and P. Beguin. 1997. Interaction between Clostridium thermocellum endoglucanase CelD and polypeptides derived from the cellulosome-integrating protein CipA: stoichiometry and cellulolytic activity of the complex. Biochem. J. 326:617–624. 9. Liu, C. C., and R. H. Doi. 1998. Properties of exgS, a gene for a major subunit of the Clostridium cellulovorans cellulosome. Gene 211:39–47. 10. Manoil, C., and J. Beckwith. 1986. A genomic approach to analyzing membrane protein topology. Science 233:1403–1408. 11. Margot, P., and D. Karamata. 1996. The wprA gene of Bacillus subtilis 168, expressed during exponential growth, encodes a cell-wall-associated protease. Microbiology 142:3437–3444. 12. Matano, Y., J. S. Park, M. A. Goldstein, and R. H. Doi. 1994. Cellulose promotes extracellular assembly of Clostridium cellulovorans cellulosomes. J. Bacteriol. 176:6952–6956. 13. Pages, S., A. Belaich, J. P. Belaich, E. Morag, R. Lamed, Y. Shoham, and E. A. Bayer. 1997. Species-specificity of the cohesin-dockerin interaction between Clostridium thermocellum and Clostridium cellulolyticum: prediction of specificity determinants of the dockerin domain. Proteins 29:517–527. 14. Shoseyov, O., M. Takagi, M. A. Goldstein, and R. H. Doi. 1992. Primary sequence analysis of Clostridium cellulovorans cellulose binding protein A. Proc. Natl. Acad. Sci. USA 89:3483–3487. 15. Tamaru, Y., and R. H. Doi. 2000. The engL gene cluster of Clostridium cellulovorans contains a gene for cellulosomal manA. J. Bacteriol. 182:244– 247. 16. Tamaru, Y., and R. H. Doi. 1999. Three surface layer homology domains at
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
cellulosomal cellulase CelD and Cip16 containing two cohesin domains from C. thermocellum formed only one type of complex even if an excess amount of Cip16 was present. By use of sedimentation equilibrium analysis, they concluded that both cohesin domains of the complex were occupied by the CelDs. Based on this observation, the mixture of mini-CbpA and rEngB-B may have formed only complexes in which both cohesin domains were occupied. We have shown that an intact C. cellulovorans EngB endoglucanase can be produced by B. subtilis WB800, that rEngB-B can interact with a mini-CbpA produced by E. coli, and that the rEngB-B–mini-CbpA complex can bind to cellulose. This is a first step that we hope will lead to the production of a variety of designer cellulosomes. In future experiments we hope to express the C. cellulovorans-derived mini-CbpAs and cellulosomal enzymes in B. subtilis and create designer cellulosomes in vivo.
VOL. 184, 2002
17. 18. 19. 20. 21.
81
23. Wood, W. A., and K. M. Bhat. 1988. Method for measuring cellulase activities. Methods Enzymol. 160:87–112. 24. Wu, S.-C., and S.-L. Wong. 1999. Development of improved pUB110-based vectors for expression and secretion studies in Bacillus subtilis. J. Biotechnol. 72:188–195. 25. Wu, X. C., W. Lee, L. Tran, and S. L. Wong. 1991. Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases. J. Bacteriol. 173:4952–4958. 26. Yaron, S., E. Morag, E. A. Bayer, R. Lamed, and Y. Shoham. 1995. Expression, purification and subunit-binding properties of cohesins 2 and 3 of the Clostridium thermocellum cellulosome. FEBS Lett. 360:121–124. 27. Ye, R., L. P. Yang, and S.-L. Wong. 1996. Construction of protease deficient Bacillus subtilis strains for expression studies: inactivation of seven extracellular protease and the intracellular LonA protease, p. 160–169. In S. K. Hong and W. J. Lim (ed.), Proceedings of the International Symposium on Recent Advances in Bioindustry. The Korean Society for Applied Microbiology, Seoul, Korea.
Downloaded from http://jb.asm.org/ on February 21, 2013 by PENN STATE UNIV
22.
the N terminus of the Clostridium cellulovorans major cellulosomal subunit EngE. J. Bacteriol. 181:3270–3276. Tamaru, Y., and R. H. Doi. 2001. Pectate lyase A, an enzymatic subunit of the Clostridium cellulovorans cellulosome. Proc. Natl. Acad. Sci. USA 98: 4125–4129. Tamaru, Y., S. Karita, A. Ibrahim, H. Chan, and R. H. Doi. 2000. A large gene cluster for the Clostridium cellulovorans cellulosome. J. Bacteriol. 182: 5906–5910. Tokatlidis, K., P. Dhurjati, and P. Beguin. 1993. Properties conferred on Clostridium thermocellum endoglucanase CelC by grafting the duplicated segment of endoglucanase CelD. Prot. Eng. 6:947–952. Wang, P.-Z., and R. H. Doi. 1984. Overlapping promoters transcribed by Bacillus subtilis 55 and 37 RNA polymerase holoenzymes during growth and stationary phase. J. Biol. Chem. 259:8619–8625. Wong, S. L. 1995. Advances in the use of Bacillus subtilis for the expression and secretion of heterologous proteins. Curr. Opin. Biotechnol. 6:517–522. Wong, S. L. 1989. Development of an inducible and enhancible expression and secretion system in Bacillus subtilis. Gene 83:215–223.
HETEROLOGOUS EXPRESSION OF engB BY B. SUBTILIS
