Exam 3 Notes 10/03/2011
Exam 3 Notes Covering pages 305380, 228245
3.1 10/3/11
Clicker question Where did most of the mass (dry weight) of this tree come from? sun air soil Molecular Basis of Inheritance What is the structure of the genome? Chromosome and DNA structure How is the genome copied? DNA replication What is the genome used for? Protein synthesis
10/03/2011
Chromosome Structure Eukaryotic chromosome structure DNA is a linear molecule Figure 12.4 & 12.5 Histone proteins Figure 16.22
Clicker questions
DNA replication involoves making ______ from DNA Protein DNA RNA rRNA DNA replication occurs in a _________ mechanism Liberal Dispersive Conservative SemiConservative
Ultimately the information in DNA is used to make Proteins Lipids Carbohydrates
DNA Structure four nucleotides complementary base pairing (hydrogen bonds) double helix 16.5 & 16.7 & 16.8 backbones are antiparallel How is DNA copied How do you make exact copies? Process for copying DNA is replication The model we use is known as the SemiConservative Model Figure 16.9 What does the structure of DNA tell you about how to copy it? DNA replication
Begins at many origins Figure 16.12 Strands must separate and unwind Helicase (unwind and separate backbone), Topoisomerases (releases the stress caused by holding backbones apart), and SSB proteins (Single stranded binding, help keep backbone apart) Figure 16.13 Add Primer Enzyme called Primase builds the primer (primer is made out of RNA nucleotides) Built in a particular direction, and antiparallel to the template its working on Replication DNA polymerase (making the DNA polymer) Figure 16.7 Fuse sections/fragments DNA ligase (responsible for tying/fusing the segment together) Primase and DNA Polymerase both are built antiparallel Sections are built 5’ – 3’ antiparallel Figure 16.13 Figure 16.17 – bigger view
3.2
10/5/11
notebook 3.2a figure 16.16 figure 16.18 – realistic version of what it looks like
clicker question “leading strand” DNA synthesis would occur in locations?
Origin 1) I and II 2) I and II 3) I and IV 4) II and III 5) II and IV
Questions What happens if the wrong base is added? Where does the energy come from? Figure 16.14 Why does DNA polymerase only build 5’ to 3’? Can errors in DNA be repaired after replication? Figure 16.19 **Listen to notes for these questions
Central Dogma Proposed right after we saw the structured DNA Flow of information within a cell The flow is largely in one direction 3.2 b in notes figure 17.3 – lays out the flow of information transcription and translation are separated spacially from each other 3.3 10/7/11
Clicker question
What sequence of amino acids would this DNA molecule produce? 3’ ATATTTTACAGGTGACGCCAG 5’ TATAAAATGTCCACTGCGGTC
a) TryLysMetSerThrAlaVal b) MetSerThrAlaVal c) ArgSerTyr
what information do you need to know to answer this question?
RNA Differs from DNA in that: Nucleotides contain a different sugar, Ribose sugar It is single stranded (only one backbone) Uracil instead of thymine AU CG Types of RNA
Messenger mRNA Rna that has the message, has the instructions for making the particular protein Ribosomal rRNA Part of ribosomes Transfer RNA tRNA Important in the process of translation, responsible for transferring amino acid
mRNA result from transcription of DNA (true for all RNAs) contains the code to build one polypeptide chain specific for every different polypeptide chain produced in a cell, you have different mRNAs Transcription RNA polymerase binds to the promoter site (TATA box) Tells us where the gene starts Tells us which backbone is the one to be transcribed Figure 17.8 RNA polymerase builds the new strand 5’ to 3’ with complementary RNA nucleotides Compliment build antiparallel to the template Figure 17.9
When RNA polymerase reaches the termination sequence it leaves the DNA and so does the RNA Only one backbone of DNA is transcribed
Clicker question The DNA sequence 5’ ATTGC would be transcribed as: 3’ TAACG figure 17.3 Prokaryotes vs. Eukaryotes Eukaryotes 3 types of RNA polymerase mRNA produced during transcription must be processed prior to translation RNA processing Capping PolyA tail If you don’t cap it and tail it wont leave he nucleus
Editing (editing the message – biggest and most important diffenece between pro and eu karyotic cells) The mRNA that is produced via transcripton and the mRNA that leaves the nucleus are differnet All introns are removed from the strand Final message is just exons with cap and a tail Figure 17.10, 17.11, 17.12, 17.13 A domain of a protein is a subunit of a structure that often has a particular function
3.4 **view simulation of translation link in moodle Clicker question The human dystrophin gene contains 2.4 million base pairs with 79 exons, while the final (mature) mRNA transcribed from this gene is 14,000 base pairs. What percentage of the DNA in this gene actually codes for the protein? A) 0.5% C) 5.0% B) 2.0% D) 25.0% almost all of the RNA is removed, Which of the following best describes transcription?
A) nucleotides are converted to amino acids B) nucleotide sequence guides amino acid sequence C) DNA nucleotides are converted into RNA nucleotides D) DNA nucleotides are used to sequence RNA nucleotides
What sequence of amino acids would this DNA molecule produce? 3’ ATATTTTACAGGTGACGCCAG 5’ 5’ TATAAAATGTCCACTGCGGTC 3’ a) TryLysMetSerThrAlaVal b) MetSerThrAlaVal c) ArgSerTyr you have to cut out the TATA box…? what information do we need to know to answer this question? Genetic code Genetic Code Written in mRNA nucleotides It is a code that is read in triplets (takes 3 nucleotides to code for one amino acid) (codons) Degenerate code
Figure 17.4 Degenerate code Figure 17.5 – DO NOT HAVE TO MEMORIZE
Translation Occurs in the cytoplasm at a ribosome Ribosomes are the sites of translation from mRNA to a polypeptide, nucleotide sequence to an amino acid sequence) 3 Compontents initiation – how we start translation chain elongation what is happening when translation is moving along termination what we have to do to terminate this Initiation Small subunit binds to 5’ end of RNA Figure 17.17 Moves to start codon (AUG) Figure 17.18 tRNA molecule that has the appropriate anticodon binds to that then the large subunit comes and “clanks” down on top of this, now the process is initiated Chain Elongation Ribosomes bind 2 tRNA molecules at the same time Figure 17.19 A site
P site E site Moves 3 nucleotides at a time chain of amino acids grows as we do this This process continues until it reaches the stop codon Termination Raches stop codon Insert releaseing factor Causes ribosomes to break apart Causes polypeptide chain to be released Figure 17.20
Figure 17.26 – overview picture of tancription and translation for eukaryotes 3.5 10/12/11 Clicker question Translate the following mRNA, pay attention to the directionality and the start codon 3’ AAAAUGAAGUCCCUGGGUAGG
**TRANSLATION STARTS ON THE 5’ END** so read left from right (skip GG, “GUA” backwards is AUG?) UGA = stop codon (here written backwards, AGU)
METLYSSerLeuGlyArg MetGlyPro
What sequence of amino acids would this DNA molecule produce? 3’ ATATTTTACAGGTGACGCCAG 5’ 5’ TATAAAATGTCCACTGCGGTC 3’ a) TryLysMetSerThrAlaVal b) MetSerThrAlaVal c) ArgSerTyr HOW DO YOU KNOW WHICH ONE TO TRANSLATE, TOP OR BOTTOM???? 5’ TATAAAATGTCCACTGCGGTC 3’ to RNA 5’ UAUAAA[AUG][UCC][ACU][GGG][GUC]
MetSerThrAlaVal
5’ TATAAAATGTCCACTGCGGTC 3’ tata box tells you you should be transcribing the other backbone
3’ ATATTTTACAGGTGACGCCAG 5’ 3’ UAUAAAAUGUCCACUGCGGUC 5’ ??? If you start with the 5’ end how do you get this (MetSerThrAlaVal) answer
SEE NOTEBOOK for lecture 3.5 and listen to notes to understand The top line shows a portion of the normal amino acid with the number indicating the position of the first amino acid shown, starting about halfway into the protein (amino acid 256) The second line shows the general region of the hene that codes for this sequence The subsewuent nucleotide sequenced show the corresponding nucleotide sequences for one or more mutated genes For each of the muttions determine: What nucleotide change has occurred What effect this change will have on the protein Suggest what effect the mutation may have (small, large, or none)
3.6 10/17/11
“Lagging Strand” DNA synthesis would occur in which
locations?
3&2… ? How does DNA contain information? What is this information used for? How is this regulated? Bacterial Genome Organization Single circular chromosome Naked DNA No Introns Located in the cytoplasm Plasmids (small bits of DNA separate from bacterial chromosome, not required for survival but create new traits/structures)
Do the differences in organization lead to functional differences? Transcription and translation can occur simultaneously Easy for the cells to take up foreign DNA (transformation)
Gene Regulation Why regulate? Energetics (cells dosent want to make things they don’t need) Control (most fof these function as enzymes… listen to notes) Figure 18.2 Bacterial operon Promoter – says where the gene starts Operator Structural genes Prokaryotes will put the same structural genes together? Listen to notes Regulator produces repressor Repressible Operon Trp Operom Figure 18.3
Repressor produced in an inactive form Binds with the corepressor Complex blocks transcription
Inducible Operon Lac Operin Repressor produced in an actuve form Blocks transcription Binds with inducer Repressor/Inducer complex inactive
Positive gene regulation cAMP cAMP Receptor Protein (CRP) figure 18.5 eukaryotic gene regulation genome structure, genes, DNA, and Chromosomes complete genome DNA sequence known Humans, chimps, flies, worms, and plants…. Exact AGCT base order is known
Genes are known Fuctions are being determined
Human genome 3 billion bases of DNA (per cell) divided into 23 chromosomes one from each parent (46 in each cell)
each chromosome is one DNA molecule 22,000 genes in humans (14,000 in flies) genes are at set positions on the chromosomes 5000 expressed in each cell type 1000 “housekeeping” genes Clicker questions Which of the following can describe the way eukaryotic genes are distributed among the chromosomes? Randomly Clustered by function Clustered by timing of expression (when you need them) Clustered by biochemical structure
Arranged in evolutionary order
There are 22,000 human genes in the genome. How many different kinds of proteins can be produced from these genes? Millions Tens of thousands (between these two answers) 5000 1000 46
Eukarotic gene regulation Prokaryotic gene regulation occurs at the level of transcripton Eukaryotic gene regulation occurs at many levels (simultaneously) Levels of regulation Chromosomal Transcriptional PostTranscriptional Translational PostTranslational Figure 18.6
3.7 10/19/11
Clicker question In a repressible operon the repressor protein is made in an ____________ shape (form) and _______bind to the opertator preventeing __________ ? Inactive, does not, transcription Active, does, transcription Inactive, does not, translation Active, does, translation (if describing an inducer operon, the answer would be the 2 nd choice) (the last two involve translation which take them out of the running automatically)
figure 18.6 – good figure of eukaryotic gene regulation
LEVELS OF REGULATION Chromosomal Level
DNA packing DNA Methylation Change the twist in the helix, which changes the groove so that genes cant bind Gene Amplification
Transcriptional Level Promoters, Enhancers Figure 18.10 Regulatory proteins Control these stated, control rate of transcription PostTranscriptional Level mRNA Processing (remove introns, cap and tail) figure 18.8 figure 18.13 can differentially edit the message (can be edited in 2 different final methods) mRNA Degradation Translational Level Regulatory Proteins PostTranslational Level
Cleavage (removing sections of amino acids) and Modification (changing amino acid shapes) Transport (transport of the protein after it is produced) and Degradation
Clciker questions
Most prokaryotic gene regulation occurs during the same process. This process it? Replication Transcription Translation
Eukaryotes regulate at which of the following levels? Transcriptional PostTranscriptional Translational All of the above (and more)
Cell Cycle The life of a cell replicated chromosome
Cytokinesis Unreplicated chromosome Cytokinesis G1 (liver, organ cell function) S (syntheisis of DNA = replication) G2 (cell function) Cell division (mitosis, miosis… depending on the cells type and location) Always start cell division with replicated chromosomes, taking them and separating them into unreplicated chromosomes
Chromosome Structure DNA and Histone proteins During Interphase: relaxed, extended During cell division supercoiled, condensed (cant betranscriped/ replicated while cell division is taking place – doesn’t last too long) Chromosomes can be unreplicated 1 molecule of DNA Chromosomes can be replicated 2 identical molecules of DNA, held together Both of these count as only one chromosome ^^figure 12.4 and 12.5
3.8 10/21//11 Clicker question A cell in G2 of interphase will have how much DNA compared to that same cell when it was in G1 of interphase half as many an equal number
twice as many
cell reproduction two steps division of the nucleus: karyokinesis (mitosis, meiosis) division of the cytoplasm cytokinesis don’t have to happen together, can be separated by days or weeks or months even Mitosis Produces identical daughter cells Identical to each other and Identical to the parental cell Figure 12.5 Mitosis is a division of the nucleus, followed by cytokinesis Always enter mitosis starting with G2 1st stage: Prophase chromosomes condense nuclear envelope breaks down
spindle forms? 2nd stage: Metaphase chromosomes go to the center of the spindle. Line up in a straight line up and down 3rd stage: Anaphase seperates replicated chromosomes into unreplicated chromosomes go from 4 replicated chromosomes to 8 unreplicated chromoseomes but there is always 8 molecules of DNA (that does not change) 4th stage: Teleophase chromosomes move to opposite sides (and cluster together) “move to poles of spindle” 5th stage: cytokinesis 4 chromosomes in each of the daughter cells figure 12.7 (consider “prometaphase” to be part of prophase) Cytokinesis division of the cytoplasm less specific of an operation cutting the cell in half, roughly equal parts (generally) some cell divisions unequal on purpose cleavage in animal cells cell plate formation in plant cells (a new cell wall)
figure 12.10
clicker questions (you will see questions like this on exam!)
A cell in Anaphase of mitosis will have how many chromosomes compared to that came cell when it was in G1 of interphase? ½ ¼ An equal number Twice as many ANSWER: Twice as many
A cell in Anaphase of mitosis will have how much DNA compared to that same cell when it was in G1 of interphase? Twice as much An equal amount ½ as much ¼ as much ANSWER: Twice as much
A cell in Anaphase of mitosis will have how much DNA compared to that same cell when it was in G1 of interphase? Twice as much An equal amount ½ as much ¼ as much ANSWER: An equal amount
Human somatic cells contain between 7 and 14 picograms of DNA. A cell containing 7 picograms would most likely be in which stage/stages of the cell cycle? G1 S G2 More than one of these ANSWER: G1 G1 chromosoes would be unreplicated (7), G2 chromosome would be replicated (14)
Human somatic cells contain between 7 and 14 picograms of DNA. A cell containing 9.5 picograms would most likely be in which stage/stages of the cell cycle?
G1 S G2 More than one of the above
ANSWER: S The only stage in which the amount of DNA in the cell is variable. It is changing/being replicated in this stage
tutoring hours – center for academic success
10/03/2011
10/03/2011
3.1 10/3/11
Clicker question Where did most of the mass (dry weight) of this tree come from? sun air soil Molecular Basis of Inheritance What is the structure of the genome? Chromosome and DNA structure How is the genome copied? DNA replication What is the genome used for? Protein synthesis
10/03/2011
Chromosome Structure Eukaryotic chromosome structure DNA is a linear molecule Figure 12.4 & 12.5 Histone proteins Figure 16.22
Clicker questions
DNA replication involoves making ______ from DNA Protein DNA RNA rRNA DNA replication occurs in a _________ mechanism Liberal Dispersive Conservative SemiConservative
Ultimately the information in DNA is used to make Proteins Lipids Carbohydrates
DNA Structure four nucleotides complementary base pairing (hydrogen bonds) double helix 16.5 & 16.7 & 16.8 backbones are antiparallel How is DNA copied How do you make exact copies? Process for copying DNA is replication The model we use is known as the SemiConservative Model Figure 16.9 What does the structure of DNA tell you about how to copy it? DNA replication
Begins at many origins Figure 16.12 Strands must separate and unwind Helicase (unwind and separate backbone), Topoisomerases (releases the stress caused by holding backbones apart), and SSB proteins (Single stranded binding, help keep backbone apart) Figure 16.13 Add Primer Enzyme called Primase builds the primer (primer is made out of RNA nucleotides) Built in a particular direction, and antiparallel to the template its working on Replication DNA polymerase (making the DNA polymer) Figure 16.7 Fuse sections/fragments DNA ligase (responsible for tying/fusing the segment together) Primase and DNA Polymerase both are built antiparallel Sections are built 5’ – 3’ antiparallel Figure 16.13 Figure 16.17 – bigger view
3.2
10/5/11
notebook 3.2a figure 16.16 figure 16.18 – realistic version of what it looks like
clicker question “leading strand” DNA synthesis would occur in locations?
Origin 1) I and II 2) I and II 3) I and IV 4) II and III 5) II and IV
Questions What happens if the wrong base is added? Where does the energy come from? Figure 16.14 Why does DNA polymerase only build 5’ to 3’? Can errors in DNA be repaired after replication? Figure 16.19 **Listen to notes for these questions
Central Dogma Proposed right after we saw the structured DNA Flow of information within a cell The flow is largely in one direction 3.2 b in notes figure 17.3 – lays out the flow of information transcription and translation are separated spacially from each other 3.3 10/7/11
Clicker question
What sequence of amino acids would this DNA molecule produce? 3’ ATATTTTACAGGTGACGCCAG 5’ TATAAAATGTCCACTGCGGTC
a) TryLysMetSerThrAlaVal b) MetSerThrAlaVal c) ArgSerTyr
what information do you need to know to answer this question?
RNA Differs from DNA in that: Nucleotides contain a different sugar, Ribose sugar It is single stranded (only one backbone) Uracil instead of thymine AU CG Types of RNA
Messenger mRNA Rna that has the message, has the instructions for making the particular protein Ribosomal rRNA Part of ribosomes Transfer RNA tRNA Important in the process of translation, responsible for transferring amino acid
mRNA result from transcription of DNA (true for all RNAs) contains the code to build one polypeptide chain specific for every different polypeptide chain produced in a cell, you have different mRNAs Transcription RNA polymerase binds to the promoter site (TATA box) Tells us where the gene starts Tells us which backbone is the one to be transcribed Figure 17.8 RNA polymerase builds the new strand 5’ to 3’ with complementary RNA nucleotides Compliment build antiparallel to the template Figure 17.9
When RNA polymerase reaches the termination sequence it leaves the DNA and so does the RNA Only one backbone of DNA is transcribed
Clicker question The DNA sequence 5’ ATTGC would be transcribed as: 3’ TAACG figure 17.3 Prokaryotes vs. Eukaryotes Eukaryotes 3 types of RNA polymerase mRNA produced during transcription must be processed prior to translation RNA processing Capping PolyA tail If you don’t cap it and tail it wont leave he nucleus
Editing (editing the message – biggest and most important diffenece between pro and eu karyotic cells) The mRNA that is produced via transcripton and the mRNA that leaves the nucleus are differnet All introns are removed from the strand Final message is just exons with cap and a tail Figure 17.10, 17.11, 17.12, 17.13 A domain of a protein is a subunit of a structure that often has a particular function
3.4 **view simulation of translation link in moodle Clicker question The human dystrophin gene contains 2.4 million base pairs with 79 exons, while the final (mature) mRNA transcribed from this gene is 14,000 base pairs. What percentage of the DNA in this gene actually codes for the protein? A) 0.5% C) 5.0% B) 2.0% D) 25.0% almost all of the RNA is removed, Which of the following best describes transcription?
A) nucleotides are converted to amino acids B) nucleotide sequence guides amino acid sequence C) DNA nucleotides are converted into RNA nucleotides D) DNA nucleotides are used to sequence RNA nucleotides
What sequence of amino acids would this DNA molecule produce? 3’ ATATTTTACAGGTGACGCCAG 5’ 5’ TATAAAATGTCCACTGCGGTC 3’ a) TryLysMetSerThrAlaVal b) MetSerThrAlaVal c) ArgSerTyr you have to cut out the TATA box…? what information do we need to know to answer this question? Genetic code Genetic Code Written in mRNA nucleotides It is a code that is read in triplets (takes 3 nucleotides to code for one amino acid) (codons) Degenerate code
Figure 17.4 Degenerate code Figure 17.5 – DO NOT HAVE TO MEMORIZE
Translation Occurs in the cytoplasm at a ribosome Ribosomes are the sites of translation from mRNA to a polypeptide, nucleotide sequence to an amino acid sequence) 3 Compontents initiation – how we start translation chain elongation what is happening when translation is moving along termination what we have to do to terminate this Initiation Small subunit binds to 5’ end of RNA Figure 17.17 Moves to start codon (AUG) Figure 17.18 tRNA molecule that has the appropriate anticodon binds to that then the large subunit comes and “clanks” down on top of this, now the process is initiated Chain Elongation Ribosomes bind 2 tRNA molecules at the same time Figure 17.19 A site
P site E site Moves 3 nucleotides at a time chain of amino acids grows as we do this This process continues until it reaches the stop codon Termination Raches stop codon Insert releaseing factor Causes ribosomes to break apart Causes polypeptide chain to be released Figure 17.20
Figure 17.26 – overview picture of tancription and translation for eukaryotes 3.5 10/12/11 Clicker question Translate the following mRNA, pay attention to the directionality and the start codon 3’ AAAAUGAAGUCCCUGGGUAGG
**TRANSLATION STARTS ON THE 5’ END** so read left from right (skip GG, “GUA” backwards is AUG?) UGA = stop codon (here written backwards, AGU)
METLYSSerLeuGlyArg MetGlyPro
What sequence of amino acids would this DNA molecule produce? 3’ ATATTTTACAGGTGACGCCAG 5’ 5’ TATAAAATGTCCACTGCGGTC 3’ a) TryLysMetSerThrAlaVal b) MetSerThrAlaVal c) ArgSerTyr HOW DO YOU KNOW WHICH ONE TO TRANSLATE, TOP OR BOTTOM???? 5’ TATAAAATGTCCACTGCGGTC 3’ to RNA 5’ UAUAAA[AUG][UCC][ACU][GGG][GUC]
MetSerThrAlaVal
5’ TATAAAATGTCCACTGCGGTC 3’ tata box tells you you should be transcribing the other backbone
3’ ATATTTTACAGGTGACGCCAG 5’ 3’ UAUAAAAUGUCCACUGCGGUC 5’ ??? If you start with the 5’ end how do you get this (MetSerThrAlaVal) answer
SEE NOTEBOOK for lecture 3.5 and listen to notes to understand The top line shows a portion of the normal amino acid with the number indicating the position of the first amino acid shown, starting about halfway into the protein (amino acid 256) The second line shows the general region of the hene that codes for this sequence The subsewuent nucleotide sequenced show the corresponding nucleotide sequences for one or more mutated genes For each of the muttions determine: What nucleotide change has occurred What effect this change will have on the protein Suggest what effect the mutation may have (small, large, or none)
3.6 10/17/11
“Lagging Strand” DNA synthesis would occur in which
locations?
3&2… ? How does DNA contain information? What is this information used for? How is this regulated? Bacterial Genome Organization Single circular chromosome Naked DNA No Introns Located in the cytoplasm Plasmids (small bits of DNA separate from bacterial chromosome, not required for survival but create new traits/structures)
Do the differences in organization lead to functional differences? Transcription and translation can occur simultaneously Easy for the cells to take up foreign DNA (transformation)
Gene Regulation Why regulate? Energetics (cells dosent want to make things they don’t need) Control (most fof these function as enzymes… listen to notes) Figure 18.2 Bacterial operon Promoter – says where the gene starts Operator Structural genes Prokaryotes will put the same structural genes together? Listen to notes Regulator produces repressor Repressible Operon Trp Operom Figure 18.3
Repressor produced in an inactive form Binds with the corepressor Complex blocks transcription
Inducible Operon Lac Operin Repressor produced in an actuve form Blocks transcription Binds with inducer Repressor/Inducer complex inactive
Positive gene regulation cAMP cAMP Receptor Protein (CRP) figure 18.5 eukaryotic gene regulation genome structure, genes, DNA, and Chromosomes complete genome DNA sequence known Humans, chimps, flies, worms, and plants…. Exact AGCT base order is known
Genes are known Fuctions are being determined
Human genome 3 billion bases of DNA (per cell) divided into 23 chromosomes one from each parent (46 in each cell)
each chromosome is one DNA molecule 22,000 genes in humans (14,000 in flies) genes are at set positions on the chromosomes 5000 expressed in each cell type 1000 “housekeeping” genes Clicker questions Which of the following can describe the way eukaryotic genes are distributed among the chromosomes? Randomly Clustered by function Clustered by timing of expression (when you need them) Clustered by biochemical structure
Arranged in evolutionary order
There are 22,000 human genes in the genome. How many different kinds of proteins can be produced from these genes? Millions Tens of thousands (between these two answers) 5000 1000 46
Eukarotic gene regulation Prokaryotic gene regulation occurs at the level of transcripton Eukaryotic gene regulation occurs at many levels (simultaneously) Levels of regulation Chromosomal Transcriptional PostTranscriptional Translational PostTranslational Figure 18.6
3.7 10/19/11
Clicker question In a repressible operon the repressor protein is made in an ____________ shape (form) and _______bind to the opertator preventeing __________ ? Inactive, does not, transcription Active, does, transcription Inactive, does not, translation Active, does, translation (if describing an inducer operon, the answer would be the 2 nd choice) (the last two involve translation which take them out of the running automatically)
figure 18.6 – good figure of eukaryotic gene regulation
LEVELS OF REGULATION Chromosomal Level
DNA packing DNA Methylation Change the twist in the helix, which changes the groove so that genes cant bind Gene Amplification
Transcriptional Level Promoters, Enhancers Figure 18.10 Regulatory proteins Control these stated, control rate of transcription PostTranscriptional Level mRNA Processing (remove introns, cap and tail) figure 18.8 figure 18.13 can differentially edit the message (can be edited in 2 different final methods) mRNA Degradation Translational Level Regulatory Proteins PostTranslational Level
Cleavage (removing sections of amino acids) and Modification (changing amino acid shapes) Transport (transport of the protein after it is produced) and Degradation
Clciker questions
Most prokaryotic gene regulation occurs during the same process. This process it? Replication Transcription Translation
Eukaryotes regulate at which of the following levels? Transcriptional PostTranscriptional Translational All of the above (and more)
Cell Cycle The life of a cell replicated chromosome
Cytokinesis Unreplicated chromosome Cytokinesis G1 (liver, organ cell function) S (syntheisis of DNA = replication) G2 (cell function) Cell division (mitosis, miosis… depending on the cells type and location) Always start cell division with replicated chromosomes, taking them and separating them into unreplicated chromosomes
Chromosome Structure DNA and Histone proteins During Interphase: relaxed, extended During cell division supercoiled, condensed (cant betranscriped/ replicated while cell division is taking place – doesn’t last too long) Chromosomes can be unreplicated 1 molecule of DNA Chromosomes can be replicated 2 identical molecules of DNA, held together Both of these count as only one chromosome ^^figure 12.4 and 12.5
3.8 10/21//11 Clicker question A cell in G2 of interphase will have how much DNA compared to that same cell when it was in G1 of interphase half as many an equal number
twice as many
cell reproduction two steps division of the nucleus: karyokinesis (mitosis, meiosis) division of the cytoplasm cytokinesis don’t have to happen together, can be separated by days or weeks or months even Mitosis Produces identical daughter cells Identical to each other and Identical to the parental cell Figure 12.5 Mitosis is a division of the nucleus, followed by cytokinesis Always enter mitosis starting with G2 1st stage: Prophase chromosomes condense nuclear envelope breaks down
spindle forms? 2nd stage: Metaphase chromosomes go to the center of the spindle. Line up in a straight line up and down 3rd stage: Anaphase seperates replicated chromosomes into unreplicated chromosomes go from 4 replicated chromosomes to 8 unreplicated chromoseomes but there is always 8 molecules of DNA (that does not change) 4th stage: Teleophase chromosomes move to opposite sides (and cluster together) “move to poles of spindle” 5th stage: cytokinesis 4 chromosomes in each of the daughter cells figure 12.7 (consider “prometaphase” to be part of prophase) Cytokinesis division of the cytoplasm less specific of an operation cutting the cell in half, roughly equal parts (generally) some cell divisions unequal on purpose cleavage in animal cells cell plate formation in plant cells (a new cell wall)
figure 12.10
clicker questions (you will see questions like this on exam!)
A cell in Anaphase of mitosis will have how many chromosomes compared to that came cell when it was in G1 of interphase? ½ ¼ An equal number Twice as many ANSWER: Twice as many
A cell in Anaphase of mitosis will have how much DNA compared to that same cell when it was in G1 of interphase? Twice as much An equal amount ½ as much ¼ as much ANSWER: Twice as much
A cell in Anaphase of mitosis will have how much DNA compared to that same cell when it was in G1 of interphase? Twice as much An equal amount ½ as much ¼ as much ANSWER: An equal amount
Human somatic cells contain between 7 and 14 picograms of DNA. A cell containing 7 picograms would most likely be in which stage/stages of the cell cycle? G1 S G2 More than one of these ANSWER: G1 G1 chromosoes would be unreplicated (7), G2 chromosome would be replicated (14)
Human somatic cells contain between 7 and 14 picograms of DNA. A cell containing 9.5 picograms would most likely be in which stage/stages of the cell cycle?
G1 S G2 More than one of the above
ANSWER: S The only stage in which the amount of DNA in the cell is variable. It is changing/being replicated in this stage
tutoring hours – center for academic success
10/03/2011
10/03/2011
