Generation of cortical neurons from mouse embryonic stem cells
PROTOCOL
Generation of cortical neurons from mouse embryonic stem cells Nicolas Gaspard1–3, Tristan Bouschet1,3, Ade`le Herpoel1, Gilles Naeije1, Jelle van den Ameele1 & Pierre Vanderhaeghen1 1Institute
of Interdisciplinary Research on Human and Molecular Biology (IRIBHM) and 2Department of Neurology, Universite´ Libre de Bruxelles (ULB), Brussels, Belgium. 3These authors contributed equally to this work. Correspondence should be addressed to P.V. ([email protected]).
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
Published online 17 September 2009; doi:10.1038/nprot.2009.157
Embryonic stem cells (ESCs) constitute a tool of great potential in neurobiology, enabling the directed differentiation of specific neural cell types. We have shown recently that neurons of the cerebral cortex can be generated from mouse ESCs cultured in a chemically defined medium that contains no morphogen, but in the presence of the sonic hedgehog inhibitor cyclopamine. Corticogenesis from ESCs recapitulates the most important steps of cortical development, leading to the generation of multipotent cortical progenitors that sequentially produce cortical pyramidal neurons displaying distinct layer-specific identities. The protocol provides a most reductionist cellular model to tackle the complex mechanisms of cortical development and function, thereby opening new perspectives for the modeling of cortical diseases and the design of novel neurological treatments, while offering an alternative to animal use. In this protocol, we describe a method by which millions of cortical neurons can be generated in 2–3 weeks, starting from a single frozen vial of ESCs.
INTRODUCTION The cerebral cortex is a highly complex brain structure, which is composed of a wide diversity of neuronal subtypes populating specific cortical layers and areas. The mechanisms involved in the generation of cortical neuron diversity remain unclear. The cerebral cortex arises through several developmental processes, which begin by forebrain induction, which is believed to constitute a ‘default’ primitive program of neural identity1. The forebrain then undergoes a dorso-ventral regionalization process, mainly through the influence of the ventral morphogen sonic hedgehog (Shh)1. This dorso-ventral patterning leads to the specification of distinct pools of neurogenic progenitors located in the dorsal and ventral part of the rostral forebrain, from which the two main populations of cortical neurons, cortical pyramidal neurons and interneurons, will be generated1. The specification of the different cortical pyramidal neurons follows a precise temporal pattern: neurons of distinct subtypes are generated sequentially and then migrate to specific layers in the cortex2, in which they display distinct patterns of gene expression and connectivity3. Despite recent progresses (reviewed in refs. 4–9), the molecular mechanisms controlling the specification of the different neuronal cell types in the developing cortex remain poorly understood, in part, due to the intrinsic complexity of the process of corticogenesis in vivo. In this context, novel in vitro reductionist approaches would be of great help to study the development, function and diseases of the cerebral cortex. Here we describe a detailed protocol of the generation of cortical neurons from mouse embryonic stem cells (ESCs), which essentially recapitulates in vitro the key features of early forebrain and cortical development10. Neural differentiation from ESCs can be achieved in multiple ways. Aggregation of ESCs into embryoid bodies (EBs), in the presence of fetal calf serum, leads to the differentiation of a small population of neural progenitors11,12. These progenitors can be further selected in stringent media that allow the survival of neural 1454 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
cells only13, and these can be further amplified using proliferative agents, such as basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF)12,13. Another approach consists of exposing EB to the neural-inducing activity of retinoic acid (RA)14 or stromal feeder cells15,16, resulting in the generation of an almost pure neural population. Several studies in recent years have sought to apply known concepts of developmental neurobiology to direct ESC differentiation and generate specific neuronal populations from ESCs, including spinal cord motor neurons17, dorsal interneurons18, cerebellar Purkinje and granule cells19,20 and midbrain dopaminergic neurons21. Derivation of neural cells with rostral identity has been reported upon differentiation in the presence17 or absence22 of serum, and neural progenitors with telencephalic identity was achieved, although in a relatively low proportion, by exposing EB-like aggregates to inhibitors of Wnt and nodal signaling23,24. The generation of a homogenous population of cortical-like glutamatergic unipolar neurons from ESCs was also reported25. However, the physiological relevance of RA in this method is puzzling as RA is known to repress forebrain identity. Furthermore, the identity of the ESC-derived neural progenitors and neurons was only partly characterized. Although most of these methods have been used successfully to study various aspects of developmental neurobiology, they suffer from two drawbacks. First, ESCs are exposed to a cocktail of unknown (contained in serum or its surrogate, knock out serum replacer (KOSR)) and/or known (RA, bFGF and EGF) signaling factors. Second, they are differentiated in EB or cell aggregates, complex three-dimensional structures in which local patterning center-like activity might form, which may lead to the generation of neural populations of mixed regional identities26. With the aim to design a faithful and reliable model of in vitro corticogenesis from ESCs, we adapted a method of neurogenesis from adherent monocultures of ESCs27. We cultured ESCs at low density in a serum-free and morphogen-free chemically defined
Day 6 Day 0 Day 12 Day 21 Figure 1 | Timetable of corticogenesis from ESCs. Approximate periods of neural induction, neurogenesis and gliogenesis are indicated. Thawed ESCs are expanded in ES media. When ES cells expansion Early differentiation Late differentiation reaching suitable density, ESCs are passaged and (Steps 1–8) (Steps 9–17) seeded onto gelatin-coated dishes. This day is (Steps 18–21) (Steps 22–31) considered as differentiation day 1. ESCs are cultivated in ES media for an additional day before Neural induction Neurogenesis ES media is changed for DDM (differentiation day Gliogenesis 0). Change to DDM marks early differentiation and neural induction. From differentiation days 2 to 10, cyclopamine is added to DDM to induce Culture in ES medium Culture in N2/B27 Culture in DDM Option A. Analysis of progenitors at day 14 dorsalization of progenitor cells. Neurogenesis Option B. Analysis of neurons at day 21 Culture in N2/B27 starts at day 6 and will proceed until day 21, Day 2 Day 10 followed by a wave of gliogenesis. At Culture in clonal medium Option C. Analysis of clones Cyclopamine differentiation day 12, cell culture that now (Step 32) Thawing Day 12 Day 1 contains a majority of progenitors and neurons are of ES cells passage onto passage onto seeded onto poly-L-lysine/laminin-coated polylysine/laminin-coated gelatine-coated coverslips dishes coversplips in N2/B27 media. Cell culture is stopped, either 2 or 9 d later, to analyze the identity of progenitors and neurons (options A and B, respectively). Alternatively, cells are cultivated in clonal conditions to test for the competence of a single isolated progenitor to generate a diverse neuronal progeny (option C). ESCs, embryonic stem cells; DDM, default defined medium.
default medium (DDM) allowing cell survival by insulin10. In these conditions, ESCs followed an efficient neurogenesis process leading first to the generation of neural progenitors, followed by neurons and finally by astroglial production (Figs. 1 and 2). Importantly, most of the neural progenitors generated in DDM display a forebrain identity, and can be fate-shifted to cortical-like identity through the use of the Shh inhibitor cyclopamine, as predicted from in vivo embryological data1. These cortical-like progenitors then generate a majority of glutamatergic neurons that display a pyramidal morphola ogy and other cardinal features of cortical
b
c
Pax6/Nestin
e 60
d
Proportion of neurons (%)
Figure 2 | ESCs and ESC-derived neural progenitors and neurons in the DDM–cyclopamine protocol. (a) Normal morphology of ESCs at day 0 before medium change to DDM. Most ESCs have undergone one cell division. (b) Normal morphology of ESC-derived neural progenitors at day 12. Note the presence of neural rosettes (arrow) in the cell clusters. (c) Normal morphology of ESC-derived neurons at day 21 (9 d after passage at day 12). Note the presence of neurites (arrow). Immunofluorescence staining of cortical markers in neural progenitors (d) and layerspecific markers in neurons (e–i). (d) Nestin+ neural progenitors (in green) also express Pax6 (in red) at day 14 (2 d after replating on glass coverslips). (e) Onset of protein expression of layer-specific markers in DDM+cyclopamine conditions. (f) Clone of Reelin+ and Satb2+ neurons derived from a single progenitor (8 d after replating in clonal conditions). (g) Tuj1+ neurons (in green) also express Tbr1 (in red) at day 21 (7 d after replating). (h) Tuj1+ neurons (in green) also express CTIP2 (in red) at day 21 (7 d after replating). (i) Tuj1+ neurons (in green) also express Satb2 (in red) at day 21 (7 d after replating on glass coverslips). Bars, 100 mm (a and b), 25 mm (c), and 10 mm (d and f–h). Panels d–i are reproduced with permission from reference 10.
neurons, including specific gene expression signatures and axonal projections determined by grafting experiments10. The addition of cyclopamine does not seem to influence neurogenesis per se, as similar proportions of neural progenitors, astrocytes and neurons are generated in the presence of cyclopamine, thus suggesting that its main effect is a fate change in the regional identity of neural cells. Importantly, cortical progenitors derived from ESCs display the characteristic time-dependent changes in competence found
Onset of the expression of layer markers in DDM+cyclo Satb2 Cux1
Reelin Satb2 Beta-tubulin3+
f
CTIP2
40 Otx1 Tbr1
20 Reelin
0 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL
Days of differentiation CTIP2/Tuj1
Tbr1/Tuj1
g
h
Cux1/Tuj1
i
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1455
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL in vivo, which allow the sequential generation of distinct classes of cortical neurons displaying layer-specific identity10, similar to what has been described for dissociated embryonic cortical progenitors in vitro28. When grafted in mouse neonatal brain, these ESC-derived neurons display patterns of axonal projections that are remarkably similar to those of native neurons of the cortex10, thus providing direct in vivo evidence for the cortical identity of the neural cells generated following DDM-cyclopamine conditions. This protocol provides a most reductionist model of the complex regional and temporal patterning events that orchestrate cortical development. In combination with the expanding tools available for the genetic engineering of mouse ESCs, it can be used in functional screens to dissect the molecular mechanisms of cortical neuron specification. ESC-derived corticogenesis also provides a novel tool to study the function of pyramidal cortical neurons in vitro, including at the electrophysiology level, thereby providing an alternative to animal-derived neuronal primary cultures for cellular and molecular biology, physiology and drug screening. Finally, as the ESC-derived cortical neurons behave like genuine cortical neurons when grafted in vivo10, they constitute an attractive source to study the feasibility of cell therapy-based repair of cortical lesions. A complete description of the biological properties of the ESC-derived cortical neurons, both in vitro and after grafting in vivo, has been previously published10. Here we describe a detailed protocol of in vitro corticogenesis, including how to monitor the identity of the generated cells. Although fully differentiated neurons representative of all cortical layers can be found in vitro and after grafting in vivo, we nevertheless observed in vitro an underrepresentation of upper layer neuronal subtypes that is also observed in cultures of genuine cortical progenitors28, suggesting that some in vivo cues required for the generation of a complete repertoire upper layer neurons are missing in vitro29,30. Experimental design This neuronal differentiation protocol is intended to generate cortical progenitors and neurons from mouse ESCs. In contrast to other methods of ESC-derived generation of the forebrain or cortical-like neurons that use morphogens or morphogen-containing serum surrogates23,31,32, this protocol uses culture media that are completely defined chemically and that are devoid of any known morphogen. In addition, this protocol does not use EB-like cell aggregates23,31,32, but instead relies on monolayer cultures that allow consistent homogenous cell–cell interactions. Thus, by minimizing exogenous influence and optimizing homogeneity, this protocol allows ESCs to follow a primitive pathway of differentiation that is highly similar to the one occurring in vivo33, thereby leading to a reliable source of physiologically relevant cortical neurons10. This protocol follows three major steps (Fig. 1): ESC expansion: ESCs are thawed and expanded in ES media. Neural induction: Proliferating ESCs are replated onto gelatincoated dishes at low density in ES medium. The next day, ES medium is changed for DDM, leading to neural induction. Late differentiation: The cells follow an intrinsic corticogenesis program, leading to a repertoire of cortical progenitors, cortical neurons and astroglial cells.
1456 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
The outcome of the differentiation process (i.e., the identity and proportion of neural progenitors and neurons) is highly dependent on three parameters, namely: ESC health and pluripotency before differentiation. ESC density at the time of plating for differentiation (Steps 9–17). Efficient dissociation and dispersion of the cells on day 12 (Steps 22–31).
ESCs. ESCs must be mycoplasma-free and expanded according to the state-of-the-art procedures of ESC technology, as previously described34. It is especially important to avoid overconfluent ESC cultures where colonies touch one another, as this might lead to unwanted precocious differentiation. This can be assessed by the presence of large and flat endodermal cells at the interface between adjacent colonies. Using overconfluent ESCs enhances endo-mesodermal differentiation in DDM conditions, at the expense of neural induction. Note that this protocol has been successfully applied to several ESC lines. In particular, it has been extensively characterized with ESC lines grown on gelatin-coated dishes, such as the E14Tg2A ESC line and several of its derivatives, and with ESC lines grown on feeder cultures such as the J1 derivative tau-GFP ESC line10. Other cell lines, including R1 and noncommercial cell lines directly derived from embryos have also been used with success (N.G., T.B., A.H. and P.V., unpublished observations). It is expected that many additional cell lines may be used, provided that their stem cell properties have been carefully shown. Each ESC line should be expanded in its respective appropriate conditions. However, we have found it useful sometimes to change culture conditions of some ESC lines growing on feeders to feeder-free conditions, provided that they remain pluripotent. This circumvents the need to eliminate the feeder layer before differentiation and to avoid feeder contamination during differentiation, which might interfere with the differentiation process. Owing to the variable proliferation rate between different cell lines, cell density at plating must be tailored to each cell line. Densities suggested in the protocol (5,000 cells per cm2) were adjusted for E14Tg2A, J1 cell lines and their derivatives. For other cell lines, we recommend testing different densities from half to twice (2,500–10,000 cells per cm2) the suggested densities. Excessive cell density inhibits neural induction, thus leading to a less-efficient production of neurons, whereas low cell density decreases cell survival and proliferation. Furthermore, we have observed that too high cell density at plating increases the proportion of midbrain and hindbrain neural progenitors. Cyclopamine. The protocol makes use of cyclopamine, a natural antagonist of the Shh pathway that acts through direct binding to the Shh receptor Smoothened (Smo)35. Cyclopamine is used here to prevent the induction of ventral neural progenitor identities. It is added during early differentiation, between days 2 and 10, at the time when endogenous Shh begins to be expressed by the differentiating cells10 (Fig. 1). We have compared several time windows (days 2–5, 6–10, 2–10 and 6–14) and found that exposure to cyclopamine during this period was the most efficient, in terms of dorsalization and cell survival. Shorter exposures lead to incomplete dorsalization, whereas longer exposure resulted
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
in a clear reduction in cell survival and proliferation. We have also tried different concentrations and found that 1 mM was the most appropriate, allowing strong inhibition of the Shh pathway without inducing significant cell death. Interestingly, this concentration is in the same order of magnitude as the EC50 of cyclopamine binding to Smo35. Differentiation process. Thorough but gentle dissociation at day 12 is mandatory to achieve proper neuronal differentiation. Incomplete dissociation leads to the persistence of aggregates of neural progenitors and decreased neurogenesis. Too harsh dissociation may lead to the loss of at least some of the early-generated neurons (Cajal–Retzius and deep layer neurons). The early differentiation period (days 2–10) is characterized by a wave of cell death, affecting mainly non-neural cells, similar to what has been previously described36. It can be observed similarly in the presence and absence of cyclopamine. For the late differentiation steps, cells are passaged at differentiation day 12 and plated onto laminin- and poly-L-lysine-coated coverslips in N2B27 medium. Laminin and poly-L-lysine are substrates classically used for in vitro adhesion of primary neural and neuronal cell cultures and are known to allow neurite outgrowth. N2B27 contains B27 and Neurobasal medium, which have been shown to increase the survival of post-mitotic neurons in vitro37. B27 should not contain vitamin A as it might be transformed into RA, resulting in a decrease in rostral forebrain identities, including cortical identity38. From differentiation day 12, cells are cultured for an additional 2 or 9 d period to determine the identity of cortical progenitors and neurons (Fig. 1, options A and B, respectively). Alternatively, cells are cultivated in clonal conditions (option C) that permit testing for the competence of one single isolated progenitor to generate different type of neurons. To this end, cells are plated at low densities and bFGF is added to the
culture medium in order to sustain cortical progenitor cell division and to support survival28. Clonal cultures are analyzed by immunofluorescence. The analysis of cortical differentiation is achieved by both immunofluorescence and RT-PCR. The identity of progenitors and neurons can be best determined at days 14 and 21, respectively. The confirmation of the cortical identity of progenitors and neurons relies on the presence of specific markers and exclusion of others. Wherever possible, use the antibodies listed in Table 1. Progenitors that are Nestin+ cells should also be Pax6+, a transcription factor that is specific for dorsal identity within the cortex, whereas most of the progenitor cells should be negative for Nkx2.1, Nkx2.2 and Isl1, markers of ventral forebrain identity. As quality antibodies for other cortical and forebrain markers, such as Emx1, Emx2 or FoxG1, are not readily available, RT-PCR should be carried out using the primers listed in Table 2. Cyclopamine treatment should result in strong upregulation of Emx1–2, while strongly reducing the expression levels of Dlx1, Lhx6 and Nkx2.1. It is also to be expected that FoxG1 levels are somewhat reduced in the cyclopamine conditions10. Beta-tubulin3+ neurons should express markers of different cortical layers such as Reelin (Cajal–Retzius cells), deep layers (TBR1, CTIP2) or superficial layers (Satb2, Cux1). Moreover, most of these neurons should be glutamatergic (Vglut1+, Vglut2+), whereas only a minority should be GABAergic (VGAT+). Changing medium. As a general rule, only the required volume of media for a defined experiment is warmed, as the media contains substances sensitive to prolonged warming (trypsin, insulin contained in the N2 supplement). When splitting cells, used medium is changed for fresh medium 1 h before passage, in order to remove dead cells and cellular debris and to stimulate cell metabolism before the stress of splitting.
TABLE 1 | List of antibodies. Antibody Acht Beta-III-tubulin/Tuj1 CTIP2 Cux1 (CDP) GAD67 GFAP Islet 1 MAP2 Nestin Nkx2.1 (TTF-1) Nkx2.2 OTX1 OTX1+2 Pax6 Reelin-G10SATB2 TBR1 Tyrosine hydroxylase VGAT VGluT1 VGluT2
Host Goat Mouse Rat Rabbit Mouse Rabbit Mouse Mouse Rabbit Rabbit Mouse Mouse Rabbit Rabbit Mouse Rabbit Rabbit Mouse Rabbit Rabbit Rabbit
Marker of cell type Cholinergic neurons Neurons Layer V and VI neurons Upper layers neurons GABA neurons Astrocytes Ventral neurons Mature neurons Neural progenitors Ventral forebrain progenitors Ventral progenitors Forebrain and midbrain progenitors Forebrain and midbrain progenitors Cortical and dorsal thalamic progenitors Cajal–Retzius cells Upper layers and some layer V neurons Preplate, layer I, V and VI neurons Dopaminergic neurons GABA neurons Glutamatergic neurons Glutamatergic neurons
Dilution 1:200 1:1,000 1:1,000 1:1,000 1:2,000 1:500 1:5 1:500 1:1,000 1:5,000 1:50 1:10 1:2,000 1:2,500 1:1,000 1:2,000 1:5,000 1:200 1:3,000 1:2,000 1:2,000
Supplier/reference Chemicon, cat. no. AB144P Covance, MMS-435P Abcam, cat. no. ab18465-100 Santa Cruz, cat. no. sc-13024 Chemicon, cat. no. AB5406 Sigma DSHB, cat. no. 40.2D6 Sigma, cat. no. M1406-2ml Covance, cat. no. PRB-315C BioPat, PA0100 DSHB, 74.5A5 DSHB Chemicon, cat. no. ab25985 Covance, PRB-278P Provided by A. Goffinet Provided by V. Tarabykin Chemicon, cat. no. AB9616 Chemicon, MAB318 Synaptic Systems Synaptic Systems Synaptic Systems
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1457
PROTOCOL TABLE 2 | List of PCR primers. Gene FoxG1 Emx2 Emx1 Dlx1 Lhx6 Nkx2.1
Forward primer sequence (5’–3’) TGAAGAGGAGGTGGAGTGCC CACCTTCTACCCCTGGCTCA CCCCTCACTCTCTTTCTTGAGCG CCAAAAGGGAAGCAGAGGAG TAGAGCCTCCCCATGTACGCC AACCTGGGCAACATGAGCGAGCTG
Reverse primer sequence (5’–3’) GCTGAACGAGGACTTGGGAA TTCTCGGTGGATGTGTGTGC CAGCCCATTCTCTTGTCCCTC CCCAGATGAGGAGTTCGGAT TGCTGCGGTGTATGCTTTTT ATCTTGACCTGCGTGGGTGTCAGG
MATERIALS © 2009 Nature Publishing Group http://www.nature.com/natureprotocols
REAGENTS
. 2-Mercaptoethanol 14.3 M (Sigma, cat. no. M-7522) (see REAGENT SETUP) ! CAUTION It is toxic, use in a fume hood and avoid exposure.
. B27 supplement without vitamin A 50 (Invitrogen, cat. no. 12587-010) . BSA 7.5% (wt/vol) (Invitrogen, cat. no. 15260-037) . Cyclopamine (Calbiochem, cat. no. 239803) (see REAGENT SETUP ! CAUTION It is a teratogen; gloves and mask should be worn when using this compound; care must be taken to prevent contact through all routes of exposure. Women of childbearing age should be extremely careful in handling cyclopamine. . DDM medium (see REAGENT SETUP) . DMEM containing4.5 g l 1 glucose (Invitrogen, cat. no. 41965-039) . DMEM/F12, GlutaMAX (Invitrogen, cat. no. 31331-028) . E14Tg2a mouse ESCs (BayGenomics, stock no. 015890-UCD). The J1 derivative tau-GFP ESC line was kindly provided by Yves-Alain Barde (Biozentrum, Basel, Switzerland). . EDTA Titriplex III (VWR, Merck, cat. no. 1.08421.1000) (see REAGENT SETUP) . ES-grade fetal bovine serum (Invitrogen, cat. no. 10439-024) (see REAGENT SETUP). . ES medium (see REAGENT SETUP) . Gelatin (Sigma, cat. no. G9391) (see REAGENT SETUP) . L-Glutamine 200 mM (Invitrogen, cat. no. 25030-024) (see REAGENT SETUP) . HCl 1 N (VWR, Merck, cat. no. 1.09057.2500 ! CAUTION It is corrosive to skin, metals and clothing. Wear eye protection and impervious gloves. Use with caution and always add acid slowly to water. Avoid contact with liquid and vapor. Use an exhaust hood. . Laminin (Becton Dickinson, cat. no. 354232) (see REAGENT SETUP) . Murine leukemia inhibitory factor (LIF) 107 U ml 1 (ESGRO, Millipore, cat. no. ESG1107) (see REAGENT SETUP) . N2 supplement 100 (Invitrogen, cat. no. 17502-048) . N2B27 medium (see REAGENT SETUP) . Neurobasal (Invitrogen, cat. no. 21103-049) . Non-essential amino acid solution 10 mM (Invitrogen, cat. no. 11140-035) . PBS without calcium and magnesium (Invitrogen, cat. no. 14190-094) . Penicillin/streptomycin 5,000 U ml 1 (Invitrogen, cat. no. 151070-063) . Poly-L-lysine (Becton Dickinson, cat. no. 354210) (see REAGENT SETUP) . Recombinant human bFGF, 157 aa (R & D Systems, cat. no. 234-FSE-025) . RNeasy Mini Kit (Qiagen, cat no. 74106) . Sodium pyruvate 100 mM (Invitrogen, cat. no. 11360) . SuperScript II Reverse Transcriptase (Invitrogen, cat. no. 18064-014) . Trypsin 2.5% (wt/vol) (Invitrogen, cat. no. 15090-046) (see REAGENT SETUP). . For antibodies see Table 1 . PCR primers (Eurogentec) see Table 2 EQUIPMENT . 0.22-mm Pore size filter (Millex-GP; Millipore, cat. no. SLGP033RS) . 10-ml Disposable syringe (Terumo, cat. no. SS-10ESZ) . 10-ml Plastic disposable pipette (Sarstedt, cat. no. 86.1254.001) . 12-Well tissue culture plate (Nunc, cat. no. 150628) . 15-mm glass coverslips (VWR, Menzel, cat no. 631-1341); see REAGENT SETUP) . 25-ml Plastic disposable pipette (Sarstedt, cat. no. 86.1685.001) . 5-ml Plastic disposable pipette (Sarstedt, cat. no. 86.1253.001) . 60-mm Tissue culture dish (Nunc, cat. no. 150288) . 92-mm Tissue culture dish (Nunc, cat. no. 150350) . Manual Cell counter 1458 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
Annealing T (1C) 60 59 58 59 55 66
Amplicon size (bp) 514 522 622 722 723 352
. Pre-plugged glass Pasteur pipettes (VWR, cat. no. 612-17990) . Tweezers sterilize by autoclaving REAGENT SETUP ES medium DMEM supplemented with 15% FBS (vol/vol), 1,000 U ml 1 of LIF, 0.1 mM of non-essential amino acids, 1 mM of sodium pyruvate, 50 U ml 1 of penicillin and streptomycin and 0.1 mM of 2-mercaptoethanol. To prepare 100 ml of ES medium, mix 70 ml of DMEM with 15 ml of FBS, 10 ml of LIF, 1 ml of non-essential amino acids, 1 ml of sodium pyruvate, 100 ml of 2-mercaptoethanol at 100 mM (obtained by diluting 50 ml of 2-mercaptoethanol stock in 7 ml of PBS) and 1 ml of penicillin/streptomycin. Add DMEM to a final volume of 100 ml, filter with a bottle-top filter (0.22 mm) and store at 4 1C. Use within 2 d. ! CAUTION 2-Mercaptoethanol is toxic; use in a fume hood and avoid exposure. DDM medium DMEM/F12 + GlutaMAX supplemented with N2 supplement (1), 0.1 mM of non-essential amino acids, 1 mM of sodium pyruvate, 500 mg ml 1 of BSA, 0.1 mM of 2-mercaptoethanol, 50 U ml 1 of penicillin and streptomycin. To prepare 500 ml of DDM, mix 450 ml of DMEM/F12 + GlutaMAX with 5 ml of N2 supplement, 5 ml of non-essential amino acids, 5 ml of sodium pyruvate, 3.33 ml of BSA, 3.5 ml of 2-mercaptoethanol stock solution and 5 ml of penicillin/streptomycin. Add DMEM/F12 + GlutaMAX to a final volume of 500 ml and filter with a bottle-top filter (0.22 mm) and store at 4 1C. Use within 1 week. Neurobasal/B27 To prepare 500 ml of Neurobasal/B27 (Neurobasal supplemented with B27 1, 2 mM glutamine, 50 U ml 1 penicillin and streptomycin), mix 450 ml of Neurobasal with 10 ml of B27 supplement without vitamin A, 5 ml of glutamine and 5 ml of penicillin/streptomycin, and add Neurobasal to a final volume of 500 ml. Filter with a bottle-top filter (0.22 mm) and store at 4 1C. Use within 1 week. N2/B27 A mixture 1:1 of DDM and Neurobasal/B27 medium. To prepare 500 ml of N2/B27, mix 250 ml of DDM with 250 ml of Neurobasal/B27. Store at 4 1C. Use within one week. m CRITICAL Check that the B27 supplement does not contain vitamin A. Clonal medium Neurobasal supplemented with B27 1, N2 1, 2 mM of glutamine, penicillin/streptomycin 1 and bFGF 0.1 ng ml 1. Store at 4 1C and use within 1 week. (Adapted with permission of Shen et al.39.) m CRITICAL For all media, warm only the volume required for a define experiment (do not warm the entire bottle). Mouse LIF Aliquot the contents of the LIF into 100 ml of aliquots and store at 4 1C for up to 1 year. Cyclopamine To prepare a stock solution at 400 mg ml 1, resuspend the provided 1 mg of cyclopamine with 2.5 ml of filtered absolute ethanol. Aliquot 500 ml into tubes and store at 20 1C for up to 1 month. Add to DDM just before warming (1,000 times dilution). ! CAUTION It is a teratogen. Gloves and mask should be worn when using this compound. Care must be taken to prevent contact through all routes of exposure. Women of childbearing age should be extremely careful in handling cyclopamine. Trypsin 0.05% (wt/vol)–EDTA 0.5 mM Prepare 100 ml of EDTA stock solution (100 mM) by dissolving 3.72 g of EDTA in 100 ml of water. To prepare 1 liter of Trypsin–EDTA solution, dilute 20 ml of the trypsin stock solution (2.5% (wt/vol)) and 5 ml of EDTA stock solution (100 mM) in 1 liter of PBS. Filter with a bottle-top filter, aliquot (50 ml) and store at 20 1C. Frozen aliquots can be stored for months. Thawed aliquots should be stored at 4 1C and used within 1 week. Gelatin coating. Stock at 0.1% (wt/vol) Dissolve 1 g of gelatin powder in 1 liter of distilled water, autoclave and filter with a bottle-top filter (0.22 mm). Gelatin solution can be stored at 4 1C for 1 week. To coat a culture dish, add sufficient volume of 0.1% (wt/vol) gelatin solution to cover the entire area of the bottom of a dish. For example, 5 or 10 ml of gelatin solution is used for 60- or 100-mm dish, respectively. Incubate
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
the dish for at least 30 min at room temperature (RT; B20 1C). Aspirate gelatin and air-dry the dishes under a sterile hood. Rinsing of the plates is not necessary. Store at RT for up to 1 week. Coverslip processing Immerse 15-mm coverslips in 1 N HCl for 1 h. Rinse thrice with 100 ml of pure water and then rinse twice with 100 ml of absolute ethanol. Air-dry on a clean piece of paper, transfer to a clean baker, cover with foil and sterilize overnight in an oven at 180 1C. Put coverslips into 12-well plates using flamed tweezers. Store at RT for an unlimited amount of time. ! CAUTION HCl corrosive to skin, metals and clothing; wear eye protection and impervious gloves; use with caution and always add acid slowly to water; avoid contact with liquid and vapor; and use an exhaust hood.
Poly-L-lysine/laminin coating To prepare a stock of poly-L-lysine, resuspend the provided powder (20 mg) with 40 ml of PBS and shake thoroughly. Prepare 1 ml aliquots and store at 20 1C. Frozen aliquots can be stored for 2 months. To prepare a stock solution of laminin, resuspend the provided powder (1 mg) with 30 ml of PBS, prepare 1.5 ml aliquots and store at 80 1C. Frozen aliquots can be stored for 6 months. To prepare the working solution of poly-L-lysine/laminin for coating (poly-L-lysine 33 mg/laminin 3 mg per ml of PBS), mix one aliquot of poly-L-lysine with one aliquot of laminin, add PBS to a final volume of 15 ml and filter (0.22 mm), using a syringe-driven filter unit. Coat coverslips with 1 ml of working solution per well of a 12-well plate for 2 h at RT. Rinse twice with PBS and dry by aspiration.
PROCEDURE ESC thawing TIMING 30 min 1| Prepare 20 ml of ES medium in a 50-ml tube and warm to 37 1C in a water bath.
2| Remove a vial of frozen ESCs from the liquid nitrogen tank. Place the vial in the 37 1C water bath until the cells begin to thaw. 3| Working in a sterile hood, wipe the outside of the vial with ethanol and slowly remove the cap. 4| Add 1 ml of warmed ES media to the vial, resuspend the cells and transfer the cell suspension to a 15-ml tube. Add 8 ml of warmed ES media and resuspend again. 5| Centrifuge for 3 min at 290g, RT. 6| Discard the supernatant by aspiration. 7| Resuspend the cells with 10 ml of ES medium. For ESC lines requiring feeders, seed ESCs onto feeder fibroblast cultures (prepared as described in ref. 34). For feeder-free ESCs, transfer the cells to a 100-mm gelatin-coated dish. Incubate the cells in an incubator at 37 1C, 5% CO2.
ESC expansion TIMING 10 min per d 8| Change the medium every day. Discard the medium and replace with 10 ml of ES medium until the cells become 60% confluent. This should occur 2–3 d after thawing.
ESC passage TIMING 1 h 30 min 9| One hour before the passage of ESCs, replace the media with 10 ml of fresh ES medium in order to remove dead cells and debris. 10| Remove the medium and rinse the cells with 10 ml of PBS, aspirate and add 2 ml of 0.05% (wt/vol) trypsin/0.5 mM EDTA per dish. 11| Incubate for 1 min at 37 1C in the incubator. 12| Pipette up/down 3–4 times with a 1-ml tip and inactivate the trypsin by adding 4 ml of ES media. Resuspend the cells by pipetting up and down with a 1-ml filter tip several times. 13| Transfer the cells to a 15-ml tube and centrifuge for 3 min at 290g, RT. 14| Aspirate the supernatant. 15| Add 2 ml of ES medium to the cell pellet and resuspend into a single-cell suspension using a Pasteur pipette. Add 8 ml of ES medium to the 2-ml cell suspension and resuspend well by pipetting up and down several times. For feeder-dependent ESCs, remove the fibroblasts by a selective adhesion procedure. To do this, plate all of the cells (feeders + ESCs) onto a 100-mm gelatin-coated dish. Place the dish in the incubator an incubator at 37 1C, 5% CO2; feeders will start attaching before ESCs. Examine the dish under the microscope every 3 min until most of the bigger cells (feeders) have attached and only smaller cells (ESCs) can be seen floating. This usually takes 15–30 min. Harvest the medium that now contains mostly ESCs and transfer to a new 15-ml falcon tube. 16| Count the cells. Between 5 and 10 millions cells are typically obtained. Adjust the concentration to 30,000 cells per ml with ES medium. m CRITICAL STEP While counting, ensure that the cells are well dispersed and present as a single-cell suspension. NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1459
PROTOCOL 17| Transfer 5 ml of suspension (i.e., 150,000 cells) onto a 60-mm gelatin-coated dish, providing a plating density of B5,000 cells per cm2. Culture the cells for 12 d in an incubator at 37 1C, 5% CO2.
Early differentiation TIMING 10 min per d 18| Remove the ES medium. Rinse the 60-mm dish with 5 ml of warm (37 1C) PBS. Remove PBS and add 5 ml of DDM. This day is considered as differentiation day 0 (Fig. 1).
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
19| After 2 d (differentiation day 2), replace the medium with DDM supplemented with cyclopamine (1 mM). ! CAUTION Cyclopamine is a teratogen. Gloves and mask should be worn when using this compound. Care must be taken to prevent contact through all routes of exposure. Women of childbearing age should be extremely careful in handling cyclopamine. 20| Culture the cells for 48 h in an incubator at 37 1C, 5% CO2 and repeat Step 19 three times until differentiation day 10. 21| On differentiation day 10, replace the medium with DDM only (no cyclopamine). ? TROUBLESHOOTING
ESC-derived neural progenitors dissociation and late differentiation TIMING 3 h on day 12 then 10 min every 2 d 22| At differentiation day 12, coat 15-mm coverslips (in 12-well plates) with poly-L-lysine and laminin (see REAGENT SETUP). 23| One hour before passaging the cells, remove the medium and add fresh N2B27 (5 ml/60-mm dish). 24| Rinse the cells with 5 ml of PBS, aspirate and add 1 ml of 0.05% (wt/vol) trypsin/0.5 mM EDTA per dish. Incubate in an incubator at 37 1C until the cells detach (usually 1–2 min). 25| Pipette the cells up and down 4–5 times with a 1-ml filter tip. 26| Inactivate the trypsin by adding 4 ml of 10% (vol/vol) FBS (in PBS) and resuspend the cells by pipetting up and down 4–5 times with a 1-ml filter tip and then 4–5 times with a Pasteur pipette. 27| Transfer to a 15-ml tube and centrifuge for 3 min at 290g, RT. 28| Aspirate the supernatant. 29| Resuspend the cell pellet in 1 ml of N2/B27 by pipetting up and down successively 4–5 times with a 1-ml filter tip, 4–5 times with a Pasteur pipette, 4–5 times with a 200-ml tip and finally 4–5 times with a 20-ml tip. Add 4 ml of N2B27 to the 1-ml cell suspension and resuspend the cells well by pipetting 4–5 times. m CRITICAL STEP Gentle but complete dissociation is mandatory to achieve optimal neuronal differentiation. 30| Count the number of cells. Usually, B10 millions cells per 60-mm dish are obtained. 31| Cells should be seeded onto coverslips at different densities depending on the downstream analysis. Use option A for the analysis of progenitors at differentiation day 14, option B for analysis of neurons at differentiation day 21 or option C for clonal analysis10. (A) Seeding of cells for analysis on differentiation day 14 TIMING 3 h (i) Seed 500 103 to 1 106 cells per well of a 12-well plate containing coated coverslips in N2/B27 medium. (ii) Culture the cells for 2 additional days in an incubator at 37 1C, 5% CO2. (B) For analysis of neurons at differentiation day 21 TIMING 3 h (i) Seed 250 103 to 500 103 cells per well of a 12-well plate containing coated coverslips in N2/B27 medium. (ii) Culture the cells for 9 additional days in an incubator at 37 1C, 5% CO2. (iii) Change the N2/B27 medium every 2 d until stopping the experiment for analysis (stop cultures at differentiation day 21). (C) For clonal analysis TIMING 3 h (i) Seed 3–5 cells per mm2 in 1 ml clonal medium10. (ii) Culture the cells for 2–8 additional days in an incubator at 37 1C, 5% CO2. (iii) Change half of the medium every 3 d until stopping the experiment for analysis (stop cultures at differentiation days 14–20). ? TROUBLESHOOTING
1460 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
Analysis of cortical differentiation TIMING RT-PCR several hours or immunofluorescence several days 32| The cortical differentiation of the neurons seeded in Step 31 A and B can be analyzed using option A immunofluorescence or option B RT-PCR. Those seeded in Step 31C should be analyzed using option A (immunofluorescence) only. (A) Immunofluorescence (i) For analysis, fix the cells at different periods of differentiation such as differentiation days 14, 21 and 28 (Fig. 1) and carry out immunofluorescence using the antibodies listed in Table 1 (see ref. 10 for immunofluorescence methods). (B) RT-PCR (i) Extract RNA using RNeasy kit from cultures at differentiation day 14 (that contain mainly progenitors at that time) following the manufacturer’s instructions. (ii) Carry out reverse transcriptase using the SuperScript II kit. (iii) Carry out PCR using the primers and conditions listed in Table 2. The PCR can be carried out with any standard PCR machine and commercially available kit. ? TROUBLESHOOTING
TIMING Steps 1–7, Thawing of ESCs: 30 min Step 8, Expansion of ESCs: 10 min per d Steps 9–17, Passage of ESCs: 1 h 30 min Steps 18–21, Early differentiation (from differentiation days 0 to 12): 10 min per d Steps 22–31, Late differentiation (from differentiation day 12): 3 h on day 12 and then 10 min every 2 d Step 32, Analysis of cortical differentiation: several days ? TROUBLESHOOTING Troubleshooting advice can be found in Table 3. TABLE 3 | Troubleshooting table. Steps
Problem
Possible reasons
Possible solutions
21 and 31
Excessive cell death (beyond days 2–10)
Improper composition of culture media
Prepare new media
Cell culture or incubator infection
Check for infection (bacterial, fungal and mycoplasmal)
Improper ESC health
Prepare new ES media. Start from an earlier passage of ES cells
Improper ESC dissociation
Check trypsin solution efficiency Increase cell dissociation Try different densities
Suboptimal cell density at plating
Increase time of selective adhesion procedure
Feeder cells carryover
Consider moving your cell line to feederfree conditions
32
Very few Nestin+ neural progenitors at day 14 and high proportion of non-neural cell types
Very few neurons at day 21
Improper composition of culture media
Prepare new media
Improper preparation of coated coverslips
Prepare new coverslips and new poly-L-lysine and laminin Try different cell densities
Suboptimal cell density at replating Improper dissociation
Check trypsin solution efficiency Increase cell dissociation
Formation of clusters of neural progenitors
Improper dissociation
Check trypsin solution efficiency Increase cell dissociation
Neural progenitors or neurons are not cortical
B27 contains vitamin A
Double check that the B27 supplement does not contain vitamin A and use B27 without vitamin A
Suboptimal cell density at plating
Try different cell densities
Cyclopamine is too old
Prepare new aliquots from cyclopamine stock powder
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1461
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL ANTICIPATED RESULTS Successful experiments produce cultures of 490% neural cells (B80% neural progenitors and B15% neurons at day 14, and B80% neurons, B10% neural progenitors and B5% glial cells at day 21). The protocol is reliable and consistent as long as special attention is paid to the health of the ESCs, the density of the cells before differentiation, cell dissociation, adherence to the correct substrates and the freshness of the media used. The expansion of ESCs and their differentiation must be followed on a daily basis by noting the changes occurring in cell morphology and cell number. At 24 h after passage of ESCs (day 0 of differentiation, just before passing cells to DDM), the cells should appear dispersed (Fig. 2a). At this time, cells are of small size and of triangular or star-like shape with a small and dense nucleus. Later during the differentiation process, the presence of neural progenitors is reflected by the formation of rosette-like structures, which can be seen from day 4 (Fig. 2b). Neural progenitors have a bipolar morphology with asymmetric processes. The presence of neurons, as early as day 6, can be ascertained by the presence of growing neurites (Fig. 2c). The final outcome of differentiation, obtaining ESC-derived cortical progenitors and neurons, should be established by combining several approaches, including immunofluorescence, RT-PCR and, ultimately, grafting experiments (described in ref. 10). Typical controls of efficient neural induction include the assessment of the proportion of neural progenitors (Nestin+ cells) and neurons (Tuj1+ and MAP-2+ cells) in immunofluorescence experiments. At day 14 (early differentiation during 12 d followed by 2 d after replating), proper neural induction should lead to the presence of B75% of neural progenitors and 15% of neurons, whereas at day 21 (early differentiation during 12 d followed by 9 d post-replating), the cell culture should be composed of 10% neural progenitors, 80% neurons and 5% glial cells. The acquisition of cortical identity should be assessed by showing the expression of dorsal forebrain/telencephalon markers. At day 14, more than 60% of the Nestin+ cells (i.e., progenitors) should express Pax6 (Fig. 2d), and Otx1–2, Emx1–2 and FoxG1 mRNA should be detected robustly by RT-PCR (cf Fig. 1 in ref. 10). Conversely, very few progenitors should express ventral forebrain markers, such as Gsh2, Nkx2.1 (both can be assessed by immunofluorescence), and Dlx1,5 or Lhx6 expression should be barely detectable (assessed by RT-PCR). At day 28, the majority of neurons should be unipolar, glutamatergic (labeled by the anti-VGluT1 or VGluT2 antibody) and only a few cells should have a multipolar morphology and GABAergic identity (labeled by VGAT antibody). Glial cells (GFAP+) should represent B10% of the cells at this differentiation time point. The efficiency of cyclopamine-induced dorsalization can be assessed by comparing DDM+cyclopamine to DDM–cyclopamine conditions. In the absence of cyclopamine, half of the progenitors should express ventral forebrain markers and half of the neurons should be GABAergic. We have found that the decrease in the proportion of neural progenitors expressing Nkx2.1 and the increase in the proportion of neurons expressing Tbr1 to be the most valuable markers of efficient dorsalization (our unpublished observations). Indeed, more than 25% of the progenitors cultured in DDM alone express Nkx2.1 at day 14, but the expression is barely observed upon the addition of cyclopamine. On the other hand, Tbr1 is expressed by more than 40% of neurons cultured in DDM+cyclopamine and by o10% of neurons cultured with DDM alone. ESC-derived cortical pyramidal neurons at day 21 comprise preplate neurons (B10% Reelin+ neurons; Fig. 2f), deep layer neurons (B40% Tbr1+; Fig. 2g) and B40% CTIP2+ neurons (Fig. 2h)) and upper layer neurons (B10% Satb2+ neurons (Fig. 2f) and B10% Cux1+ neurons (Fig. 2i)). When seeding cells for clonal dilution (Step 31C), the first Tuj1+ neurons can be detected as early as 1 d after culture. After 8 d in culture, clones contain 8.9 ± 3.6 cells, of which 41.4 ± 3% are Tuj1+ neurons (mean ± s.e.m.). Reelin+, CTIP2+ and Satb2+ neurons are obtained in similar proportions as in non-clonal cultures10 (N.G., J.v.d.A. and P.V., unpublished results).
ACKNOWLEDGMENTS We are grateful to other members of the lab and IRIBHM for their help and advice. This work was funded by the Belgian FNRS/FRSM, the Belgian Queen Elizabeth Medical Foundation, the Simone et Pierre Clerdent Foundation, the Action de Recherches Concerte´es (ARC) Programs, the Interuniversity Attraction Poles Program (IUAP), Belgian State, Federal Office, the Walloon Region Excellence Program CIBLES (to P.V.) and the EU Marie Curie Fellowship Program (to T.B. and P.V.). P.V. is a Senior Research Associate of the FNRS and N.G. and T.B. were funded as Research Fellows of the FNRS. T.B. is a Fellow of the EU Marie Curie Program. AUTHOR CONTRIBUTIONS N.G., T.B., A.H., G.N. and J.v.d.A. performed all experiments. All authors contributed to the design and analysis of experiment. N.G., T.B. and P.V. wrote the paper. Published online at http://www.natureprotocols.com. Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions. 1. Wilson, S.W. & Rubenstein, J.L. Induction and dorsoventral patterning of the telencephalon. Neuron 28, 641–651 (2000).
1462 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
2. Bayer, S. & Altman, J. Neocortical Development (Raven Press, New York, 1991). 3. Hevner, R.F. et al. Beyond laminar fate: toward a molecular classification of cortical projection/pyramidal neurons. Dev. Neurosci. 25, 139–151 (2003). 4. Molyneaux, B.J., Arlotta, P., Menezes, J.R. & Macklis, J.D. Neuronal subtype specification in the cerebral cortex. Nat. Rev. Neurosci. 8, 427–437 (2007). 5. Leone, D.P., Srinivasan, K., Chen, B., Alcamo, E. & McConnell, S.K. The determination of projection neuron identity in the developing cerebral cortex. Curr. Opin. Neurobiol. 18, 28–35 (2008). 6. Kokovay, E., Shen, Q. & Temple, S. The incredible elastic brain: how neural stem cells expand our minds. Neuron 60, 420–429 (2008). 7. Noctor, S.C., Martinez-Cerdeno, V. & Kriegstein, A.R. Neural stem and progenitor cells in cortical development. Novartis. Found. Symp. 288, 59–73 (2007). 8. Gotz, M. & Sommer, L. Cortical development: the art of generating cell diversity. Development 132, 3327–3332 (2005); discussion 73–78, 96–98. 9. Schuurmans, C. & Guillemot, F. Molecular mechanisms underlying cell fate specification in the developing telencephalon. Curr. Opin. Neurobiol. 12, 26–34 (2002). 10. Gaspard, N. et al. An intrinsic mechanism of corticogenesis from embryonic stem cells. Nature 455, 351–357 (2008).
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL 11. Wobus, A.M., Grosse, R. & Schoneich, J. Specific effects of nerve growth factor on the differentiation pattern of mouse embryonic stem cells in vitro. Biomed. Biochim. Acta 47, 965–973 (1988). 12. Bain, G., Kitchens, D., Yao, M., Huettner, J.E. & Gottlieb, D.I. Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168, 342–357 (1995). 13. Okabe, S., Forsberg-Nilsson, K., Spiro, A.C., Segal, M. & McKay, R.D. Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech. Dev. 59, 89–102 (1996). 14. Fraichard, A. et al. In vitro differentiation of embryonic stem cells into glial cells and functional neurons. J. Cell Sci. 108 (Part 10): 3181–3188 (1995). 15. Ueno, M. et al. Neural conversion of ES cells by an inductive activity on human amniotic membrane matrix. Proc. Natl. Acad. Sci. USA 103, 9554–9559 (2006). 16. Kawasaki, H. et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 28, 31–40 (2000). 17. Wichterle, H., Lieberam, I., Porter, J.A. & Jessell, T.M. Directed differentiation of embryonic stem cells into motor neurons. Cell 110, 385–397 (2002). 18. Murashov, A.K. et al. Directed differentiation of embryonic stem cells into dorsal interneurons. FASEB J. 19, 252–254 (2005). 19. Salero, E. & Hatten, M.E. Differentiation of ES cells into cerebellar neurons. Proc. Natl. Acad. Sci. USA 104, 2997–3002 (2007). 20. Su, H.L. et al. Generation of cerebellar neuron precursors from embryonic stem cells. Dev. Biol. 290, 287–296 (2006). 21. Lee, S.H., Lumelsky, N., Studer, L., Auerbach, J.M. & McKay, R.D. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat. Biotechnol. 18, 675–679 (2000). 22. Bouhon, I.A., Kato, H., Chandran, S. & Allen, N.D. Neural differentiation of mouse embryonic stem cells in chemically defined medium. Brain Res. Bull. 68, 62–75 (2005). 23. Watanabe, K. et al. Directed differentiation of telencephalic precursors from embryonic stem cells. Nat. Neurosci. 8, 288–296 (2005). 24. Eiraku, M. et al. Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell 3, 519–532 (2008). 25. Bibel, M. et al. Differentiation of mouse embryonic stem cells into a defined neuronal lineage. Nat. Neurosci. 7, 1003–1009 (2004).
26. Du, Z.W. & Zhang, S.C. Neural differentiation from embryonic stem cells: which way? Stem Cells Dev. 13, 372–381 (2004). 27. Ying, Q.L., Stavridis, M., Griffiths, D., Li, M. & Smith, A. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat. Biotechnol. 21, 183–186 (2003). 28. Shen, Q. et al. The timing of cortical neurogenesis is encoded within lineages of individual progenitor cells. Nat. Neurosci. 9, 743–751 (2006). 29. Dehay, C. & Kennedy, H. Cell-cycle control and cortical development. Nat. Rev. Neurosci. 8, 438–450 (2007). 30. Javaherian, A. & Kriegstein, A. A stem cell niche for intermediate progenitor cells of the embryonic cortex. Cereb. Cortex 19 (Suppl 1): i70–i77 (2009). 31. Bibel, M., Richter, J., Lacroix, E. & Barde, Y.A. Generation of a defined and uniform population of CNS progenitors and neurons from mouse embryonic stem cells. Nat. Protoc. 2, 1034–1043 (2007). 32. Eiraku, M. et al. Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell 3, 519–532 (2008). 33. Levine, A.J. & Brivanlou, A.H. Proposal of a model of mammalian neural induction. Dev. Biol. 308, 247–256 (2007). 34. Nagy, A., Gertsenstein, M., Vintersen, K. & Behringer, R. Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2003). 35. Chen, J.K., Taipale, J., Cooper, M.K. & Beachy, P.A. Inhibition of hedgehog signaling by direct binding of cyclopamine to Smoothened. Genes Dev. 16, 2743–2748 (2002). 36. Watanabe, K. et al. Directed differentiation of telencephalic precursors from embryonic stem cells. Nat. Neurosci. 8, 288–296 (2005). 37. Brewer, G.J., Torricelli, J.R., Evege, E.K. & Price, P.J. Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J. Neurosci. Res. 35, 567–576 (1993). 38. Okada, Y., Shimazaki, T., Sobue, G. & Okano, H. Retinoic-acid-concentrationdependent acquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells. Dev. Biol. 275, 124–142 (2004). 39. Shen, Q. et al. The timing of cortical neurogenesis is encoded within lineages of individual progenitor cells. Nat. Neurosci. 9, 743–751 (2006).
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1463
Generation of cortical neurons from mouse embryonic stem cells Nicolas Gaspard1–3, Tristan Bouschet1,3, Ade`le Herpoel1, Gilles Naeije1, Jelle van den Ameele1 & Pierre Vanderhaeghen1 1Institute
of Interdisciplinary Research on Human and Molecular Biology (IRIBHM) and 2Department of Neurology, Universite´ Libre de Bruxelles (ULB), Brussels, Belgium. 3These authors contributed equally to this work. Correspondence should be addressed to P.V. ([email protected]).
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
Published online 17 September 2009; doi:10.1038/nprot.2009.157
Embryonic stem cells (ESCs) constitute a tool of great potential in neurobiology, enabling the directed differentiation of specific neural cell types. We have shown recently that neurons of the cerebral cortex can be generated from mouse ESCs cultured in a chemically defined medium that contains no morphogen, but in the presence of the sonic hedgehog inhibitor cyclopamine. Corticogenesis from ESCs recapitulates the most important steps of cortical development, leading to the generation of multipotent cortical progenitors that sequentially produce cortical pyramidal neurons displaying distinct layer-specific identities. The protocol provides a most reductionist cellular model to tackle the complex mechanisms of cortical development and function, thereby opening new perspectives for the modeling of cortical diseases and the design of novel neurological treatments, while offering an alternative to animal use. In this protocol, we describe a method by which millions of cortical neurons can be generated in 2–3 weeks, starting from a single frozen vial of ESCs.
INTRODUCTION The cerebral cortex is a highly complex brain structure, which is composed of a wide diversity of neuronal subtypes populating specific cortical layers and areas. The mechanisms involved in the generation of cortical neuron diversity remain unclear. The cerebral cortex arises through several developmental processes, which begin by forebrain induction, which is believed to constitute a ‘default’ primitive program of neural identity1. The forebrain then undergoes a dorso-ventral regionalization process, mainly through the influence of the ventral morphogen sonic hedgehog (Shh)1. This dorso-ventral patterning leads to the specification of distinct pools of neurogenic progenitors located in the dorsal and ventral part of the rostral forebrain, from which the two main populations of cortical neurons, cortical pyramidal neurons and interneurons, will be generated1. The specification of the different cortical pyramidal neurons follows a precise temporal pattern: neurons of distinct subtypes are generated sequentially and then migrate to specific layers in the cortex2, in which they display distinct patterns of gene expression and connectivity3. Despite recent progresses (reviewed in refs. 4–9), the molecular mechanisms controlling the specification of the different neuronal cell types in the developing cortex remain poorly understood, in part, due to the intrinsic complexity of the process of corticogenesis in vivo. In this context, novel in vitro reductionist approaches would be of great help to study the development, function and diseases of the cerebral cortex. Here we describe a detailed protocol of the generation of cortical neurons from mouse embryonic stem cells (ESCs), which essentially recapitulates in vitro the key features of early forebrain and cortical development10. Neural differentiation from ESCs can be achieved in multiple ways. Aggregation of ESCs into embryoid bodies (EBs), in the presence of fetal calf serum, leads to the differentiation of a small population of neural progenitors11,12. These progenitors can be further selected in stringent media that allow the survival of neural 1454 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
cells only13, and these can be further amplified using proliferative agents, such as basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF)12,13. Another approach consists of exposing EB to the neural-inducing activity of retinoic acid (RA)14 or stromal feeder cells15,16, resulting in the generation of an almost pure neural population. Several studies in recent years have sought to apply known concepts of developmental neurobiology to direct ESC differentiation and generate specific neuronal populations from ESCs, including spinal cord motor neurons17, dorsal interneurons18, cerebellar Purkinje and granule cells19,20 and midbrain dopaminergic neurons21. Derivation of neural cells with rostral identity has been reported upon differentiation in the presence17 or absence22 of serum, and neural progenitors with telencephalic identity was achieved, although in a relatively low proportion, by exposing EB-like aggregates to inhibitors of Wnt and nodal signaling23,24. The generation of a homogenous population of cortical-like glutamatergic unipolar neurons from ESCs was also reported25. However, the physiological relevance of RA in this method is puzzling as RA is known to repress forebrain identity. Furthermore, the identity of the ESC-derived neural progenitors and neurons was only partly characterized. Although most of these methods have been used successfully to study various aspects of developmental neurobiology, they suffer from two drawbacks. First, ESCs are exposed to a cocktail of unknown (contained in serum or its surrogate, knock out serum replacer (KOSR)) and/or known (RA, bFGF and EGF) signaling factors. Second, they are differentiated in EB or cell aggregates, complex three-dimensional structures in which local patterning center-like activity might form, which may lead to the generation of neural populations of mixed regional identities26. With the aim to design a faithful and reliable model of in vitro corticogenesis from ESCs, we adapted a method of neurogenesis from adherent monocultures of ESCs27. We cultured ESCs at low density in a serum-free and morphogen-free chemically defined
Day 6 Day 0 Day 12 Day 21 Figure 1 | Timetable of corticogenesis from ESCs. Approximate periods of neural induction, neurogenesis and gliogenesis are indicated. Thawed ESCs are expanded in ES media. When ES cells expansion Early differentiation Late differentiation reaching suitable density, ESCs are passaged and (Steps 1–8) (Steps 9–17) seeded onto gelatin-coated dishes. This day is (Steps 18–21) (Steps 22–31) considered as differentiation day 1. ESCs are cultivated in ES media for an additional day before Neural induction Neurogenesis ES media is changed for DDM (differentiation day Gliogenesis 0). Change to DDM marks early differentiation and neural induction. From differentiation days 2 to 10, cyclopamine is added to DDM to induce Culture in ES medium Culture in N2/B27 Culture in DDM Option A. Analysis of progenitors at day 14 dorsalization of progenitor cells. Neurogenesis Option B. Analysis of neurons at day 21 Culture in N2/B27 starts at day 6 and will proceed until day 21, Day 2 Day 10 followed by a wave of gliogenesis. At Culture in clonal medium Option C. Analysis of clones Cyclopamine differentiation day 12, cell culture that now (Step 32) Thawing Day 12 Day 1 contains a majority of progenitors and neurons are of ES cells passage onto passage onto seeded onto poly-L-lysine/laminin-coated polylysine/laminin-coated gelatine-coated coverslips dishes coversplips in N2/B27 media. Cell culture is stopped, either 2 or 9 d later, to analyze the identity of progenitors and neurons (options A and B, respectively). Alternatively, cells are cultivated in clonal conditions to test for the competence of a single isolated progenitor to generate a diverse neuronal progeny (option C). ESCs, embryonic stem cells; DDM, default defined medium.
default medium (DDM) allowing cell survival by insulin10. In these conditions, ESCs followed an efficient neurogenesis process leading first to the generation of neural progenitors, followed by neurons and finally by astroglial production (Figs. 1 and 2). Importantly, most of the neural progenitors generated in DDM display a forebrain identity, and can be fate-shifted to cortical-like identity through the use of the Shh inhibitor cyclopamine, as predicted from in vivo embryological data1. These cortical-like progenitors then generate a majority of glutamatergic neurons that display a pyramidal morphola ogy and other cardinal features of cortical
b
c
Pax6/Nestin
e 60
d
Proportion of neurons (%)
Figure 2 | ESCs and ESC-derived neural progenitors and neurons in the DDM–cyclopamine protocol. (a) Normal morphology of ESCs at day 0 before medium change to DDM. Most ESCs have undergone one cell division. (b) Normal morphology of ESC-derived neural progenitors at day 12. Note the presence of neural rosettes (arrow) in the cell clusters. (c) Normal morphology of ESC-derived neurons at day 21 (9 d after passage at day 12). Note the presence of neurites (arrow). Immunofluorescence staining of cortical markers in neural progenitors (d) and layerspecific markers in neurons (e–i). (d) Nestin+ neural progenitors (in green) also express Pax6 (in red) at day 14 (2 d after replating on glass coverslips). (e) Onset of protein expression of layer-specific markers in DDM+cyclopamine conditions. (f) Clone of Reelin+ and Satb2+ neurons derived from a single progenitor (8 d after replating in clonal conditions). (g) Tuj1+ neurons (in green) also express Tbr1 (in red) at day 21 (7 d after replating). (h) Tuj1+ neurons (in green) also express CTIP2 (in red) at day 21 (7 d after replating). (i) Tuj1+ neurons (in green) also express Satb2 (in red) at day 21 (7 d after replating on glass coverslips). Bars, 100 mm (a and b), 25 mm (c), and 10 mm (d and f–h). Panels d–i are reproduced with permission from reference 10.
neurons, including specific gene expression signatures and axonal projections determined by grafting experiments10. The addition of cyclopamine does not seem to influence neurogenesis per se, as similar proportions of neural progenitors, astrocytes and neurons are generated in the presence of cyclopamine, thus suggesting that its main effect is a fate change in the regional identity of neural cells. Importantly, cortical progenitors derived from ESCs display the characteristic time-dependent changes in competence found
Onset of the expression of layer markers in DDM+cyclo Satb2 Cux1
Reelin Satb2 Beta-tubulin3+
f
CTIP2
40 Otx1 Tbr1
20 Reelin
0 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL
Days of differentiation CTIP2/Tuj1
Tbr1/Tuj1
g
h
Cux1/Tuj1
i
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1455
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL in vivo, which allow the sequential generation of distinct classes of cortical neurons displaying layer-specific identity10, similar to what has been described for dissociated embryonic cortical progenitors in vitro28. When grafted in mouse neonatal brain, these ESC-derived neurons display patterns of axonal projections that are remarkably similar to those of native neurons of the cortex10, thus providing direct in vivo evidence for the cortical identity of the neural cells generated following DDM-cyclopamine conditions. This protocol provides a most reductionist model of the complex regional and temporal patterning events that orchestrate cortical development. In combination with the expanding tools available for the genetic engineering of mouse ESCs, it can be used in functional screens to dissect the molecular mechanisms of cortical neuron specification. ESC-derived corticogenesis also provides a novel tool to study the function of pyramidal cortical neurons in vitro, including at the electrophysiology level, thereby providing an alternative to animal-derived neuronal primary cultures for cellular and molecular biology, physiology and drug screening. Finally, as the ESC-derived cortical neurons behave like genuine cortical neurons when grafted in vivo10, they constitute an attractive source to study the feasibility of cell therapy-based repair of cortical lesions. A complete description of the biological properties of the ESC-derived cortical neurons, both in vitro and after grafting in vivo, has been previously published10. Here we describe a detailed protocol of in vitro corticogenesis, including how to monitor the identity of the generated cells. Although fully differentiated neurons representative of all cortical layers can be found in vitro and after grafting in vivo, we nevertheless observed in vitro an underrepresentation of upper layer neuronal subtypes that is also observed in cultures of genuine cortical progenitors28, suggesting that some in vivo cues required for the generation of a complete repertoire upper layer neurons are missing in vitro29,30. Experimental design This neuronal differentiation protocol is intended to generate cortical progenitors and neurons from mouse ESCs. In contrast to other methods of ESC-derived generation of the forebrain or cortical-like neurons that use morphogens or morphogen-containing serum surrogates23,31,32, this protocol uses culture media that are completely defined chemically and that are devoid of any known morphogen. In addition, this protocol does not use EB-like cell aggregates23,31,32, but instead relies on monolayer cultures that allow consistent homogenous cell–cell interactions. Thus, by minimizing exogenous influence and optimizing homogeneity, this protocol allows ESCs to follow a primitive pathway of differentiation that is highly similar to the one occurring in vivo33, thereby leading to a reliable source of physiologically relevant cortical neurons10. This protocol follows three major steps (Fig. 1): ESC expansion: ESCs are thawed and expanded in ES media. Neural induction: Proliferating ESCs are replated onto gelatincoated dishes at low density in ES medium. The next day, ES medium is changed for DDM, leading to neural induction. Late differentiation: The cells follow an intrinsic corticogenesis program, leading to a repertoire of cortical progenitors, cortical neurons and astroglial cells.
1456 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
The outcome of the differentiation process (i.e., the identity and proportion of neural progenitors and neurons) is highly dependent on three parameters, namely: ESC health and pluripotency before differentiation. ESC density at the time of plating for differentiation (Steps 9–17). Efficient dissociation and dispersion of the cells on day 12 (Steps 22–31).
ESCs. ESCs must be mycoplasma-free and expanded according to the state-of-the-art procedures of ESC technology, as previously described34. It is especially important to avoid overconfluent ESC cultures where colonies touch one another, as this might lead to unwanted precocious differentiation. This can be assessed by the presence of large and flat endodermal cells at the interface between adjacent colonies. Using overconfluent ESCs enhances endo-mesodermal differentiation in DDM conditions, at the expense of neural induction. Note that this protocol has been successfully applied to several ESC lines. In particular, it has been extensively characterized with ESC lines grown on gelatin-coated dishes, such as the E14Tg2A ESC line and several of its derivatives, and with ESC lines grown on feeder cultures such as the J1 derivative tau-GFP ESC line10. Other cell lines, including R1 and noncommercial cell lines directly derived from embryos have also been used with success (N.G., T.B., A.H. and P.V., unpublished observations). It is expected that many additional cell lines may be used, provided that their stem cell properties have been carefully shown. Each ESC line should be expanded in its respective appropriate conditions. However, we have found it useful sometimes to change culture conditions of some ESC lines growing on feeders to feeder-free conditions, provided that they remain pluripotent. This circumvents the need to eliminate the feeder layer before differentiation and to avoid feeder contamination during differentiation, which might interfere with the differentiation process. Owing to the variable proliferation rate between different cell lines, cell density at plating must be tailored to each cell line. Densities suggested in the protocol (5,000 cells per cm2) were adjusted for E14Tg2A, J1 cell lines and their derivatives. For other cell lines, we recommend testing different densities from half to twice (2,500–10,000 cells per cm2) the suggested densities. Excessive cell density inhibits neural induction, thus leading to a less-efficient production of neurons, whereas low cell density decreases cell survival and proliferation. Furthermore, we have observed that too high cell density at plating increases the proportion of midbrain and hindbrain neural progenitors. Cyclopamine. The protocol makes use of cyclopamine, a natural antagonist of the Shh pathway that acts through direct binding to the Shh receptor Smoothened (Smo)35. Cyclopamine is used here to prevent the induction of ventral neural progenitor identities. It is added during early differentiation, between days 2 and 10, at the time when endogenous Shh begins to be expressed by the differentiating cells10 (Fig. 1). We have compared several time windows (days 2–5, 6–10, 2–10 and 6–14) and found that exposure to cyclopamine during this period was the most efficient, in terms of dorsalization and cell survival. Shorter exposures lead to incomplete dorsalization, whereas longer exposure resulted
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
in a clear reduction in cell survival and proliferation. We have also tried different concentrations and found that 1 mM was the most appropriate, allowing strong inhibition of the Shh pathway without inducing significant cell death. Interestingly, this concentration is in the same order of magnitude as the EC50 of cyclopamine binding to Smo35. Differentiation process. Thorough but gentle dissociation at day 12 is mandatory to achieve proper neuronal differentiation. Incomplete dissociation leads to the persistence of aggregates of neural progenitors and decreased neurogenesis. Too harsh dissociation may lead to the loss of at least some of the early-generated neurons (Cajal–Retzius and deep layer neurons). The early differentiation period (days 2–10) is characterized by a wave of cell death, affecting mainly non-neural cells, similar to what has been previously described36. It can be observed similarly in the presence and absence of cyclopamine. For the late differentiation steps, cells are passaged at differentiation day 12 and plated onto laminin- and poly-L-lysine-coated coverslips in N2B27 medium. Laminin and poly-L-lysine are substrates classically used for in vitro adhesion of primary neural and neuronal cell cultures and are known to allow neurite outgrowth. N2B27 contains B27 and Neurobasal medium, which have been shown to increase the survival of post-mitotic neurons in vitro37. B27 should not contain vitamin A as it might be transformed into RA, resulting in a decrease in rostral forebrain identities, including cortical identity38. From differentiation day 12, cells are cultured for an additional 2 or 9 d period to determine the identity of cortical progenitors and neurons (Fig. 1, options A and B, respectively). Alternatively, cells are cultivated in clonal conditions (option C) that permit testing for the competence of one single isolated progenitor to generate different type of neurons. To this end, cells are plated at low densities and bFGF is added to the
culture medium in order to sustain cortical progenitor cell division and to support survival28. Clonal cultures are analyzed by immunofluorescence. The analysis of cortical differentiation is achieved by both immunofluorescence and RT-PCR. The identity of progenitors and neurons can be best determined at days 14 and 21, respectively. The confirmation of the cortical identity of progenitors and neurons relies on the presence of specific markers and exclusion of others. Wherever possible, use the antibodies listed in Table 1. Progenitors that are Nestin+ cells should also be Pax6+, a transcription factor that is specific for dorsal identity within the cortex, whereas most of the progenitor cells should be negative for Nkx2.1, Nkx2.2 and Isl1, markers of ventral forebrain identity. As quality antibodies for other cortical and forebrain markers, such as Emx1, Emx2 or FoxG1, are not readily available, RT-PCR should be carried out using the primers listed in Table 2. Cyclopamine treatment should result in strong upregulation of Emx1–2, while strongly reducing the expression levels of Dlx1, Lhx6 and Nkx2.1. It is also to be expected that FoxG1 levels are somewhat reduced in the cyclopamine conditions10. Beta-tubulin3+ neurons should express markers of different cortical layers such as Reelin (Cajal–Retzius cells), deep layers (TBR1, CTIP2) or superficial layers (Satb2, Cux1). Moreover, most of these neurons should be glutamatergic (Vglut1+, Vglut2+), whereas only a minority should be GABAergic (VGAT+). Changing medium. As a general rule, only the required volume of media for a defined experiment is warmed, as the media contains substances sensitive to prolonged warming (trypsin, insulin contained in the N2 supplement). When splitting cells, used medium is changed for fresh medium 1 h before passage, in order to remove dead cells and cellular debris and to stimulate cell metabolism before the stress of splitting.
TABLE 1 | List of antibodies. Antibody Acht Beta-III-tubulin/Tuj1 CTIP2 Cux1 (CDP) GAD67 GFAP Islet 1 MAP2 Nestin Nkx2.1 (TTF-1) Nkx2.2 OTX1 OTX1+2 Pax6 Reelin-G10SATB2 TBR1 Tyrosine hydroxylase VGAT VGluT1 VGluT2
Host Goat Mouse Rat Rabbit Mouse Rabbit Mouse Mouse Rabbit Rabbit Mouse Mouse Rabbit Rabbit Mouse Rabbit Rabbit Mouse Rabbit Rabbit Rabbit
Marker of cell type Cholinergic neurons Neurons Layer V and VI neurons Upper layers neurons GABA neurons Astrocytes Ventral neurons Mature neurons Neural progenitors Ventral forebrain progenitors Ventral progenitors Forebrain and midbrain progenitors Forebrain and midbrain progenitors Cortical and dorsal thalamic progenitors Cajal–Retzius cells Upper layers and some layer V neurons Preplate, layer I, V and VI neurons Dopaminergic neurons GABA neurons Glutamatergic neurons Glutamatergic neurons
Dilution 1:200 1:1,000 1:1,000 1:1,000 1:2,000 1:500 1:5 1:500 1:1,000 1:5,000 1:50 1:10 1:2,000 1:2,500 1:1,000 1:2,000 1:5,000 1:200 1:3,000 1:2,000 1:2,000
Supplier/reference Chemicon, cat. no. AB144P Covance, MMS-435P Abcam, cat. no. ab18465-100 Santa Cruz, cat. no. sc-13024 Chemicon, cat. no. AB5406 Sigma DSHB, cat. no. 40.2D6 Sigma, cat. no. M1406-2ml Covance, cat. no. PRB-315C BioPat, PA0100 DSHB, 74.5A5 DSHB Chemicon, cat. no. ab25985 Covance, PRB-278P Provided by A. Goffinet Provided by V. Tarabykin Chemicon, cat. no. AB9616 Chemicon, MAB318 Synaptic Systems Synaptic Systems Synaptic Systems
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1457
PROTOCOL TABLE 2 | List of PCR primers. Gene FoxG1 Emx2 Emx1 Dlx1 Lhx6 Nkx2.1
Forward primer sequence (5’–3’) TGAAGAGGAGGTGGAGTGCC CACCTTCTACCCCTGGCTCA CCCCTCACTCTCTTTCTTGAGCG CCAAAAGGGAAGCAGAGGAG TAGAGCCTCCCCATGTACGCC AACCTGGGCAACATGAGCGAGCTG
Reverse primer sequence (5’–3’) GCTGAACGAGGACTTGGGAA TTCTCGGTGGATGTGTGTGC CAGCCCATTCTCTTGTCCCTC CCCAGATGAGGAGTTCGGAT TGCTGCGGTGTATGCTTTTT ATCTTGACCTGCGTGGGTGTCAGG
MATERIALS © 2009 Nature Publishing Group http://www.nature.com/natureprotocols
REAGENTS
. 2-Mercaptoethanol 14.3 M (Sigma, cat. no. M-7522) (see REAGENT SETUP) ! CAUTION It is toxic, use in a fume hood and avoid exposure.
. B27 supplement without vitamin A 50 (Invitrogen, cat. no. 12587-010) . BSA 7.5% (wt/vol) (Invitrogen, cat. no. 15260-037) . Cyclopamine (Calbiochem, cat. no. 239803) (see REAGENT SETUP ! CAUTION It is a teratogen; gloves and mask should be worn when using this compound; care must be taken to prevent contact through all routes of exposure. Women of childbearing age should be extremely careful in handling cyclopamine. . DDM medium (see REAGENT SETUP) . DMEM containing4.5 g l 1 glucose (Invitrogen, cat. no. 41965-039) . DMEM/F12, GlutaMAX (Invitrogen, cat. no. 31331-028) . E14Tg2a mouse ESCs (BayGenomics, stock no. 015890-UCD). The J1 derivative tau-GFP ESC line was kindly provided by Yves-Alain Barde (Biozentrum, Basel, Switzerland). . EDTA Titriplex III (VWR, Merck, cat. no. 1.08421.1000) (see REAGENT SETUP) . ES-grade fetal bovine serum (Invitrogen, cat. no. 10439-024) (see REAGENT SETUP). . ES medium (see REAGENT SETUP) . Gelatin (Sigma, cat. no. G9391) (see REAGENT SETUP) . L-Glutamine 200 mM (Invitrogen, cat. no. 25030-024) (see REAGENT SETUP) . HCl 1 N (VWR, Merck, cat. no. 1.09057.2500 ! CAUTION It is corrosive to skin, metals and clothing. Wear eye protection and impervious gloves. Use with caution and always add acid slowly to water. Avoid contact with liquid and vapor. Use an exhaust hood. . Laminin (Becton Dickinson, cat. no. 354232) (see REAGENT SETUP) . Murine leukemia inhibitory factor (LIF) 107 U ml 1 (ESGRO, Millipore, cat. no. ESG1107) (see REAGENT SETUP) . N2 supplement 100 (Invitrogen, cat. no. 17502-048) . N2B27 medium (see REAGENT SETUP) . Neurobasal (Invitrogen, cat. no. 21103-049) . Non-essential amino acid solution 10 mM (Invitrogen, cat. no. 11140-035) . PBS without calcium and magnesium (Invitrogen, cat. no. 14190-094) . Penicillin/streptomycin 5,000 U ml 1 (Invitrogen, cat. no. 151070-063) . Poly-L-lysine (Becton Dickinson, cat. no. 354210) (see REAGENT SETUP) . Recombinant human bFGF, 157 aa (R & D Systems, cat. no. 234-FSE-025) . RNeasy Mini Kit (Qiagen, cat no. 74106) . Sodium pyruvate 100 mM (Invitrogen, cat. no. 11360) . SuperScript II Reverse Transcriptase (Invitrogen, cat. no. 18064-014) . Trypsin 2.5% (wt/vol) (Invitrogen, cat. no. 15090-046) (see REAGENT SETUP). . For antibodies see Table 1 . PCR primers (Eurogentec) see Table 2 EQUIPMENT . 0.22-mm Pore size filter (Millex-GP; Millipore, cat. no. SLGP033RS) . 10-ml Disposable syringe (Terumo, cat. no. SS-10ESZ) . 10-ml Plastic disposable pipette (Sarstedt, cat. no. 86.1254.001) . 12-Well tissue culture plate (Nunc, cat. no. 150628) . 15-mm glass coverslips (VWR, Menzel, cat no. 631-1341); see REAGENT SETUP) . 25-ml Plastic disposable pipette (Sarstedt, cat. no. 86.1685.001) . 5-ml Plastic disposable pipette (Sarstedt, cat. no. 86.1253.001) . 60-mm Tissue culture dish (Nunc, cat. no. 150288) . 92-mm Tissue culture dish (Nunc, cat. no. 150350) . Manual Cell counter 1458 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
Annealing T (1C) 60 59 58 59 55 66
Amplicon size (bp) 514 522 622 722 723 352
. Pre-plugged glass Pasteur pipettes (VWR, cat. no. 612-17990) . Tweezers sterilize by autoclaving REAGENT SETUP ES medium DMEM supplemented with 15% FBS (vol/vol), 1,000 U ml 1 of LIF, 0.1 mM of non-essential amino acids, 1 mM of sodium pyruvate, 50 U ml 1 of penicillin and streptomycin and 0.1 mM of 2-mercaptoethanol. To prepare 100 ml of ES medium, mix 70 ml of DMEM with 15 ml of FBS, 10 ml of LIF, 1 ml of non-essential amino acids, 1 ml of sodium pyruvate, 100 ml of 2-mercaptoethanol at 100 mM (obtained by diluting 50 ml of 2-mercaptoethanol stock in 7 ml of PBS) and 1 ml of penicillin/streptomycin. Add DMEM to a final volume of 100 ml, filter with a bottle-top filter (0.22 mm) and store at 4 1C. Use within 2 d. ! CAUTION 2-Mercaptoethanol is toxic; use in a fume hood and avoid exposure. DDM medium DMEM/F12 + GlutaMAX supplemented with N2 supplement (1), 0.1 mM of non-essential amino acids, 1 mM of sodium pyruvate, 500 mg ml 1 of BSA, 0.1 mM of 2-mercaptoethanol, 50 U ml 1 of penicillin and streptomycin. To prepare 500 ml of DDM, mix 450 ml of DMEM/F12 + GlutaMAX with 5 ml of N2 supplement, 5 ml of non-essential amino acids, 5 ml of sodium pyruvate, 3.33 ml of BSA, 3.5 ml of 2-mercaptoethanol stock solution and 5 ml of penicillin/streptomycin. Add DMEM/F12 + GlutaMAX to a final volume of 500 ml and filter with a bottle-top filter (0.22 mm) and store at 4 1C. Use within 1 week. Neurobasal/B27 To prepare 500 ml of Neurobasal/B27 (Neurobasal supplemented with B27 1, 2 mM glutamine, 50 U ml 1 penicillin and streptomycin), mix 450 ml of Neurobasal with 10 ml of B27 supplement without vitamin A, 5 ml of glutamine and 5 ml of penicillin/streptomycin, and add Neurobasal to a final volume of 500 ml. Filter with a bottle-top filter (0.22 mm) and store at 4 1C. Use within 1 week. N2/B27 A mixture 1:1 of DDM and Neurobasal/B27 medium. To prepare 500 ml of N2/B27, mix 250 ml of DDM with 250 ml of Neurobasal/B27. Store at 4 1C. Use within one week. m CRITICAL Check that the B27 supplement does not contain vitamin A. Clonal medium Neurobasal supplemented with B27 1, N2 1, 2 mM of glutamine, penicillin/streptomycin 1 and bFGF 0.1 ng ml 1. Store at 4 1C and use within 1 week. (Adapted with permission of Shen et al.39.) m CRITICAL For all media, warm only the volume required for a define experiment (do not warm the entire bottle). Mouse LIF Aliquot the contents of the LIF into 100 ml of aliquots and store at 4 1C for up to 1 year. Cyclopamine To prepare a stock solution at 400 mg ml 1, resuspend the provided 1 mg of cyclopamine with 2.5 ml of filtered absolute ethanol. Aliquot 500 ml into tubes and store at 20 1C for up to 1 month. Add to DDM just before warming (1,000 times dilution). ! CAUTION It is a teratogen. Gloves and mask should be worn when using this compound. Care must be taken to prevent contact through all routes of exposure. Women of childbearing age should be extremely careful in handling cyclopamine. Trypsin 0.05% (wt/vol)–EDTA 0.5 mM Prepare 100 ml of EDTA stock solution (100 mM) by dissolving 3.72 g of EDTA in 100 ml of water. To prepare 1 liter of Trypsin–EDTA solution, dilute 20 ml of the trypsin stock solution (2.5% (wt/vol)) and 5 ml of EDTA stock solution (100 mM) in 1 liter of PBS. Filter with a bottle-top filter, aliquot (50 ml) and store at 20 1C. Frozen aliquots can be stored for months. Thawed aliquots should be stored at 4 1C and used within 1 week. Gelatin coating. Stock at 0.1% (wt/vol) Dissolve 1 g of gelatin powder in 1 liter of distilled water, autoclave and filter with a bottle-top filter (0.22 mm). Gelatin solution can be stored at 4 1C for 1 week. To coat a culture dish, add sufficient volume of 0.1% (wt/vol) gelatin solution to cover the entire area of the bottom of a dish. For example, 5 or 10 ml of gelatin solution is used for 60- or 100-mm dish, respectively. Incubate
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
the dish for at least 30 min at room temperature (RT; B20 1C). Aspirate gelatin and air-dry the dishes under a sterile hood. Rinsing of the plates is not necessary. Store at RT for up to 1 week. Coverslip processing Immerse 15-mm coverslips in 1 N HCl for 1 h. Rinse thrice with 100 ml of pure water and then rinse twice with 100 ml of absolute ethanol. Air-dry on a clean piece of paper, transfer to a clean baker, cover with foil and sterilize overnight in an oven at 180 1C. Put coverslips into 12-well plates using flamed tweezers. Store at RT for an unlimited amount of time. ! CAUTION HCl corrosive to skin, metals and clothing; wear eye protection and impervious gloves; use with caution and always add acid slowly to water; avoid contact with liquid and vapor; and use an exhaust hood.
Poly-L-lysine/laminin coating To prepare a stock of poly-L-lysine, resuspend the provided powder (20 mg) with 40 ml of PBS and shake thoroughly. Prepare 1 ml aliquots and store at 20 1C. Frozen aliquots can be stored for 2 months. To prepare a stock solution of laminin, resuspend the provided powder (1 mg) with 30 ml of PBS, prepare 1.5 ml aliquots and store at 80 1C. Frozen aliquots can be stored for 6 months. To prepare the working solution of poly-L-lysine/laminin for coating (poly-L-lysine 33 mg/laminin 3 mg per ml of PBS), mix one aliquot of poly-L-lysine with one aliquot of laminin, add PBS to a final volume of 15 ml and filter (0.22 mm), using a syringe-driven filter unit. Coat coverslips with 1 ml of working solution per well of a 12-well plate for 2 h at RT. Rinse twice with PBS and dry by aspiration.
PROCEDURE ESC thawing TIMING 30 min 1| Prepare 20 ml of ES medium in a 50-ml tube and warm to 37 1C in a water bath.
2| Remove a vial of frozen ESCs from the liquid nitrogen tank. Place the vial in the 37 1C water bath until the cells begin to thaw. 3| Working in a sterile hood, wipe the outside of the vial with ethanol and slowly remove the cap. 4| Add 1 ml of warmed ES media to the vial, resuspend the cells and transfer the cell suspension to a 15-ml tube. Add 8 ml of warmed ES media and resuspend again. 5| Centrifuge for 3 min at 290g, RT. 6| Discard the supernatant by aspiration. 7| Resuspend the cells with 10 ml of ES medium. For ESC lines requiring feeders, seed ESCs onto feeder fibroblast cultures (prepared as described in ref. 34). For feeder-free ESCs, transfer the cells to a 100-mm gelatin-coated dish. Incubate the cells in an incubator at 37 1C, 5% CO2.
ESC expansion TIMING 10 min per d 8| Change the medium every day. Discard the medium and replace with 10 ml of ES medium until the cells become 60% confluent. This should occur 2–3 d after thawing.
ESC passage TIMING 1 h 30 min 9| One hour before the passage of ESCs, replace the media with 10 ml of fresh ES medium in order to remove dead cells and debris. 10| Remove the medium and rinse the cells with 10 ml of PBS, aspirate and add 2 ml of 0.05% (wt/vol) trypsin/0.5 mM EDTA per dish. 11| Incubate for 1 min at 37 1C in the incubator. 12| Pipette up/down 3–4 times with a 1-ml tip and inactivate the trypsin by adding 4 ml of ES media. Resuspend the cells by pipetting up and down with a 1-ml filter tip several times. 13| Transfer the cells to a 15-ml tube and centrifuge for 3 min at 290g, RT. 14| Aspirate the supernatant. 15| Add 2 ml of ES medium to the cell pellet and resuspend into a single-cell suspension using a Pasteur pipette. Add 8 ml of ES medium to the 2-ml cell suspension and resuspend well by pipetting up and down several times. For feeder-dependent ESCs, remove the fibroblasts by a selective adhesion procedure. To do this, plate all of the cells (feeders + ESCs) onto a 100-mm gelatin-coated dish. Place the dish in the incubator an incubator at 37 1C, 5% CO2; feeders will start attaching before ESCs. Examine the dish under the microscope every 3 min until most of the bigger cells (feeders) have attached and only smaller cells (ESCs) can be seen floating. This usually takes 15–30 min. Harvest the medium that now contains mostly ESCs and transfer to a new 15-ml falcon tube. 16| Count the cells. Between 5 and 10 millions cells are typically obtained. Adjust the concentration to 30,000 cells per ml with ES medium. m CRITICAL STEP While counting, ensure that the cells are well dispersed and present as a single-cell suspension. NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1459
PROTOCOL 17| Transfer 5 ml of suspension (i.e., 150,000 cells) onto a 60-mm gelatin-coated dish, providing a plating density of B5,000 cells per cm2. Culture the cells for 12 d in an incubator at 37 1C, 5% CO2.
Early differentiation TIMING 10 min per d 18| Remove the ES medium. Rinse the 60-mm dish with 5 ml of warm (37 1C) PBS. Remove PBS and add 5 ml of DDM. This day is considered as differentiation day 0 (Fig. 1).
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
19| After 2 d (differentiation day 2), replace the medium with DDM supplemented with cyclopamine (1 mM). ! CAUTION Cyclopamine is a teratogen. Gloves and mask should be worn when using this compound. Care must be taken to prevent contact through all routes of exposure. Women of childbearing age should be extremely careful in handling cyclopamine. 20| Culture the cells for 48 h in an incubator at 37 1C, 5% CO2 and repeat Step 19 three times until differentiation day 10. 21| On differentiation day 10, replace the medium with DDM only (no cyclopamine). ? TROUBLESHOOTING
ESC-derived neural progenitors dissociation and late differentiation TIMING 3 h on day 12 then 10 min every 2 d 22| At differentiation day 12, coat 15-mm coverslips (in 12-well plates) with poly-L-lysine and laminin (see REAGENT SETUP). 23| One hour before passaging the cells, remove the medium and add fresh N2B27 (5 ml/60-mm dish). 24| Rinse the cells with 5 ml of PBS, aspirate and add 1 ml of 0.05% (wt/vol) trypsin/0.5 mM EDTA per dish. Incubate in an incubator at 37 1C until the cells detach (usually 1–2 min). 25| Pipette the cells up and down 4–5 times with a 1-ml filter tip. 26| Inactivate the trypsin by adding 4 ml of 10% (vol/vol) FBS (in PBS) and resuspend the cells by pipetting up and down 4–5 times with a 1-ml filter tip and then 4–5 times with a Pasteur pipette. 27| Transfer to a 15-ml tube and centrifuge for 3 min at 290g, RT. 28| Aspirate the supernatant. 29| Resuspend the cell pellet in 1 ml of N2/B27 by pipetting up and down successively 4–5 times with a 1-ml filter tip, 4–5 times with a Pasteur pipette, 4–5 times with a 200-ml tip and finally 4–5 times with a 20-ml tip. Add 4 ml of N2B27 to the 1-ml cell suspension and resuspend the cells well by pipetting 4–5 times. m CRITICAL STEP Gentle but complete dissociation is mandatory to achieve optimal neuronal differentiation. 30| Count the number of cells. Usually, B10 millions cells per 60-mm dish are obtained. 31| Cells should be seeded onto coverslips at different densities depending on the downstream analysis. Use option A for the analysis of progenitors at differentiation day 14, option B for analysis of neurons at differentiation day 21 or option C for clonal analysis10. (A) Seeding of cells for analysis on differentiation day 14 TIMING 3 h (i) Seed 500 103 to 1 106 cells per well of a 12-well plate containing coated coverslips in N2/B27 medium. (ii) Culture the cells for 2 additional days in an incubator at 37 1C, 5% CO2. (B) For analysis of neurons at differentiation day 21 TIMING 3 h (i) Seed 250 103 to 500 103 cells per well of a 12-well plate containing coated coverslips in N2/B27 medium. (ii) Culture the cells for 9 additional days in an incubator at 37 1C, 5% CO2. (iii) Change the N2/B27 medium every 2 d until stopping the experiment for analysis (stop cultures at differentiation day 21). (C) For clonal analysis TIMING 3 h (i) Seed 3–5 cells per mm2 in 1 ml clonal medium10. (ii) Culture the cells for 2–8 additional days in an incubator at 37 1C, 5% CO2. (iii) Change half of the medium every 3 d until stopping the experiment for analysis (stop cultures at differentiation days 14–20). ? TROUBLESHOOTING
1460 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
Analysis of cortical differentiation TIMING RT-PCR several hours or immunofluorescence several days 32| The cortical differentiation of the neurons seeded in Step 31 A and B can be analyzed using option A immunofluorescence or option B RT-PCR. Those seeded in Step 31C should be analyzed using option A (immunofluorescence) only. (A) Immunofluorescence (i) For analysis, fix the cells at different periods of differentiation such as differentiation days 14, 21 and 28 (Fig. 1) and carry out immunofluorescence using the antibodies listed in Table 1 (see ref. 10 for immunofluorescence methods). (B) RT-PCR (i) Extract RNA using RNeasy kit from cultures at differentiation day 14 (that contain mainly progenitors at that time) following the manufacturer’s instructions. (ii) Carry out reverse transcriptase using the SuperScript II kit. (iii) Carry out PCR using the primers and conditions listed in Table 2. The PCR can be carried out with any standard PCR machine and commercially available kit. ? TROUBLESHOOTING
TIMING Steps 1–7, Thawing of ESCs: 30 min Step 8, Expansion of ESCs: 10 min per d Steps 9–17, Passage of ESCs: 1 h 30 min Steps 18–21, Early differentiation (from differentiation days 0 to 12): 10 min per d Steps 22–31, Late differentiation (from differentiation day 12): 3 h on day 12 and then 10 min every 2 d Step 32, Analysis of cortical differentiation: several days ? TROUBLESHOOTING Troubleshooting advice can be found in Table 3. TABLE 3 | Troubleshooting table. Steps
Problem
Possible reasons
Possible solutions
21 and 31
Excessive cell death (beyond days 2–10)
Improper composition of culture media
Prepare new media
Cell culture or incubator infection
Check for infection (bacterial, fungal and mycoplasmal)
Improper ESC health
Prepare new ES media. Start from an earlier passage of ES cells
Improper ESC dissociation
Check trypsin solution efficiency Increase cell dissociation Try different densities
Suboptimal cell density at plating
Increase time of selective adhesion procedure
Feeder cells carryover
Consider moving your cell line to feederfree conditions
32
Very few Nestin+ neural progenitors at day 14 and high proportion of non-neural cell types
Very few neurons at day 21
Improper composition of culture media
Prepare new media
Improper preparation of coated coverslips
Prepare new coverslips and new poly-L-lysine and laminin Try different cell densities
Suboptimal cell density at replating Improper dissociation
Check trypsin solution efficiency Increase cell dissociation
Formation of clusters of neural progenitors
Improper dissociation
Check trypsin solution efficiency Increase cell dissociation
Neural progenitors or neurons are not cortical
B27 contains vitamin A
Double check that the B27 supplement does not contain vitamin A and use B27 without vitamin A
Suboptimal cell density at plating
Try different cell densities
Cyclopamine is too old
Prepare new aliquots from cyclopamine stock powder
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1461
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL ANTICIPATED RESULTS Successful experiments produce cultures of 490% neural cells (B80% neural progenitors and B15% neurons at day 14, and B80% neurons, B10% neural progenitors and B5% glial cells at day 21). The protocol is reliable and consistent as long as special attention is paid to the health of the ESCs, the density of the cells before differentiation, cell dissociation, adherence to the correct substrates and the freshness of the media used. The expansion of ESCs and their differentiation must be followed on a daily basis by noting the changes occurring in cell morphology and cell number. At 24 h after passage of ESCs (day 0 of differentiation, just before passing cells to DDM), the cells should appear dispersed (Fig. 2a). At this time, cells are of small size and of triangular or star-like shape with a small and dense nucleus. Later during the differentiation process, the presence of neural progenitors is reflected by the formation of rosette-like structures, which can be seen from day 4 (Fig. 2b). Neural progenitors have a bipolar morphology with asymmetric processes. The presence of neurons, as early as day 6, can be ascertained by the presence of growing neurites (Fig. 2c). The final outcome of differentiation, obtaining ESC-derived cortical progenitors and neurons, should be established by combining several approaches, including immunofluorescence, RT-PCR and, ultimately, grafting experiments (described in ref. 10). Typical controls of efficient neural induction include the assessment of the proportion of neural progenitors (Nestin+ cells) and neurons (Tuj1+ and MAP-2+ cells) in immunofluorescence experiments. At day 14 (early differentiation during 12 d followed by 2 d after replating), proper neural induction should lead to the presence of B75% of neural progenitors and 15% of neurons, whereas at day 21 (early differentiation during 12 d followed by 9 d post-replating), the cell culture should be composed of 10% neural progenitors, 80% neurons and 5% glial cells. The acquisition of cortical identity should be assessed by showing the expression of dorsal forebrain/telencephalon markers. At day 14, more than 60% of the Nestin+ cells (i.e., progenitors) should express Pax6 (Fig. 2d), and Otx1–2, Emx1–2 and FoxG1 mRNA should be detected robustly by RT-PCR (cf Fig. 1 in ref. 10). Conversely, very few progenitors should express ventral forebrain markers, such as Gsh2, Nkx2.1 (both can be assessed by immunofluorescence), and Dlx1,5 or Lhx6 expression should be barely detectable (assessed by RT-PCR). At day 28, the majority of neurons should be unipolar, glutamatergic (labeled by the anti-VGluT1 or VGluT2 antibody) and only a few cells should have a multipolar morphology and GABAergic identity (labeled by VGAT antibody). Glial cells (GFAP+) should represent B10% of the cells at this differentiation time point. The efficiency of cyclopamine-induced dorsalization can be assessed by comparing DDM+cyclopamine to DDM–cyclopamine conditions. In the absence of cyclopamine, half of the progenitors should express ventral forebrain markers and half of the neurons should be GABAergic. We have found that the decrease in the proportion of neural progenitors expressing Nkx2.1 and the increase in the proportion of neurons expressing Tbr1 to be the most valuable markers of efficient dorsalization (our unpublished observations). Indeed, more than 25% of the progenitors cultured in DDM alone express Nkx2.1 at day 14, but the expression is barely observed upon the addition of cyclopamine. On the other hand, Tbr1 is expressed by more than 40% of neurons cultured in DDM+cyclopamine and by o10% of neurons cultured with DDM alone. ESC-derived cortical pyramidal neurons at day 21 comprise preplate neurons (B10% Reelin+ neurons; Fig. 2f), deep layer neurons (B40% Tbr1+; Fig. 2g) and B40% CTIP2+ neurons (Fig. 2h)) and upper layer neurons (B10% Satb2+ neurons (Fig. 2f) and B10% Cux1+ neurons (Fig. 2i)). When seeding cells for clonal dilution (Step 31C), the first Tuj1+ neurons can be detected as early as 1 d after culture. After 8 d in culture, clones contain 8.9 ± 3.6 cells, of which 41.4 ± 3% are Tuj1+ neurons (mean ± s.e.m.). Reelin+, CTIP2+ and Satb2+ neurons are obtained in similar proportions as in non-clonal cultures10 (N.G., J.v.d.A. and P.V., unpublished results).
ACKNOWLEDGMENTS We are grateful to other members of the lab and IRIBHM for their help and advice. This work was funded by the Belgian FNRS/FRSM, the Belgian Queen Elizabeth Medical Foundation, the Simone et Pierre Clerdent Foundation, the Action de Recherches Concerte´es (ARC) Programs, the Interuniversity Attraction Poles Program (IUAP), Belgian State, Federal Office, the Walloon Region Excellence Program CIBLES (to P.V.) and the EU Marie Curie Fellowship Program (to T.B. and P.V.). P.V. is a Senior Research Associate of the FNRS and N.G. and T.B. were funded as Research Fellows of the FNRS. T.B. is a Fellow of the EU Marie Curie Program. AUTHOR CONTRIBUTIONS N.G., T.B., A.H., G.N. and J.v.d.A. performed all experiments. All authors contributed to the design and analysis of experiment. N.G., T.B. and P.V. wrote the paper. Published online at http://www.natureprotocols.com. Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions. 1. Wilson, S.W. & Rubenstein, J.L. Induction and dorsoventral patterning of the telencephalon. Neuron 28, 641–651 (2000).
1462 | VOL.4 NO.10 | 2009 | NATURE PROTOCOLS
2. Bayer, S. & Altman, J. Neocortical Development (Raven Press, New York, 1991). 3. Hevner, R.F. et al. Beyond laminar fate: toward a molecular classification of cortical projection/pyramidal neurons. Dev. Neurosci. 25, 139–151 (2003). 4. Molyneaux, B.J., Arlotta, P., Menezes, J.R. & Macklis, J.D. Neuronal subtype specification in the cerebral cortex. Nat. Rev. Neurosci. 8, 427–437 (2007). 5. Leone, D.P., Srinivasan, K., Chen, B., Alcamo, E. & McConnell, S.K. The determination of projection neuron identity in the developing cerebral cortex. Curr. Opin. Neurobiol. 18, 28–35 (2008). 6. Kokovay, E., Shen, Q. & Temple, S. The incredible elastic brain: how neural stem cells expand our minds. Neuron 60, 420–429 (2008). 7. Noctor, S.C., Martinez-Cerdeno, V. & Kriegstein, A.R. Neural stem and progenitor cells in cortical development. Novartis. Found. Symp. 288, 59–73 (2007). 8. Gotz, M. & Sommer, L. Cortical development: the art of generating cell diversity. Development 132, 3327–3332 (2005); discussion 73–78, 96–98. 9. Schuurmans, C. & Guillemot, F. Molecular mechanisms underlying cell fate specification in the developing telencephalon. Curr. Opin. Neurobiol. 12, 26–34 (2002). 10. Gaspard, N. et al. An intrinsic mechanism of corticogenesis from embryonic stem cells. Nature 455, 351–357 (2008).
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PROTOCOL 11. Wobus, A.M., Grosse, R. & Schoneich, J. Specific effects of nerve growth factor on the differentiation pattern of mouse embryonic stem cells in vitro. Biomed. Biochim. Acta 47, 965–973 (1988). 12. Bain, G., Kitchens, D., Yao, M., Huettner, J.E. & Gottlieb, D.I. Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168, 342–357 (1995). 13. Okabe, S., Forsberg-Nilsson, K., Spiro, A.C., Segal, M. & McKay, R.D. Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech. Dev. 59, 89–102 (1996). 14. Fraichard, A. et al. In vitro differentiation of embryonic stem cells into glial cells and functional neurons. J. Cell Sci. 108 (Part 10): 3181–3188 (1995). 15. Ueno, M. et al. Neural conversion of ES cells by an inductive activity on human amniotic membrane matrix. Proc. Natl. Acad. Sci. USA 103, 9554–9559 (2006). 16. Kawasaki, H. et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 28, 31–40 (2000). 17. Wichterle, H., Lieberam, I., Porter, J.A. & Jessell, T.M. Directed differentiation of embryonic stem cells into motor neurons. Cell 110, 385–397 (2002). 18. Murashov, A.K. et al. Directed differentiation of embryonic stem cells into dorsal interneurons. FASEB J. 19, 252–254 (2005). 19. Salero, E. & Hatten, M.E. Differentiation of ES cells into cerebellar neurons. Proc. Natl. Acad. Sci. USA 104, 2997–3002 (2007). 20. Su, H.L. et al. Generation of cerebellar neuron precursors from embryonic stem cells. Dev. Biol. 290, 287–296 (2006). 21. Lee, S.H., Lumelsky, N., Studer, L., Auerbach, J.M. & McKay, R.D. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat. Biotechnol. 18, 675–679 (2000). 22. Bouhon, I.A., Kato, H., Chandran, S. & Allen, N.D. Neural differentiation of mouse embryonic stem cells in chemically defined medium. Brain Res. Bull. 68, 62–75 (2005). 23. Watanabe, K. et al. Directed differentiation of telencephalic precursors from embryonic stem cells. Nat. Neurosci. 8, 288–296 (2005). 24. Eiraku, M. et al. Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell 3, 519–532 (2008). 25. Bibel, M. et al. Differentiation of mouse embryonic stem cells into a defined neuronal lineage. Nat. Neurosci. 7, 1003–1009 (2004).
26. Du, Z.W. & Zhang, S.C. Neural differentiation from embryonic stem cells: which way? Stem Cells Dev. 13, 372–381 (2004). 27. Ying, Q.L., Stavridis, M., Griffiths, D., Li, M. & Smith, A. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat. Biotechnol. 21, 183–186 (2003). 28. Shen, Q. et al. The timing of cortical neurogenesis is encoded within lineages of individual progenitor cells. Nat. Neurosci. 9, 743–751 (2006). 29. Dehay, C. & Kennedy, H. Cell-cycle control and cortical development. Nat. Rev. Neurosci. 8, 438–450 (2007). 30. Javaherian, A. & Kriegstein, A. A stem cell niche for intermediate progenitor cells of the embryonic cortex. Cereb. Cortex 19 (Suppl 1): i70–i77 (2009). 31. Bibel, M., Richter, J., Lacroix, E. & Barde, Y.A. Generation of a defined and uniform population of CNS progenitors and neurons from mouse embryonic stem cells. Nat. Protoc. 2, 1034–1043 (2007). 32. Eiraku, M. et al. Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell 3, 519–532 (2008). 33. Levine, A.J. & Brivanlou, A.H. Proposal of a model of mammalian neural induction. Dev. Biol. 308, 247–256 (2007). 34. Nagy, A., Gertsenstein, M., Vintersen, K. & Behringer, R. Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2003). 35. Chen, J.K., Taipale, J., Cooper, M.K. & Beachy, P.A. Inhibition of hedgehog signaling by direct binding of cyclopamine to Smoothened. Genes Dev. 16, 2743–2748 (2002). 36. Watanabe, K. et al. Directed differentiation of telencephalic precursors from embryonic stem cells. Nat. Neurosci. 8, 288–296 (2005). 37. Brewer, G.J., Torricelli, J.R., Evege, E.K. & Price, P.J. Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J. Neurosci. Res. 35, 567–576 (1993). 38. Okada, Y., Shimazaki, T., Sobue, G. & Okano, H. Retinoic-acid-concentrationdependent acquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells. Dev. Biol. 275, 124–142 (2004). 39. Shen, Q. et al. The timing of cortical neurogenesis is encoded within lineages of individual progenitor cells. Nat. Neurosci. 9, 743–751 (2006).
NATURE PROTOCOLS | VOL.4 NO.10 | 2009 | 1463
