Problem Sets
Biology 226 Winter2014 Genetics
Name:_______________ Student #: ____________Time of Tut.: ____
Problem Set 5: Recombinant DNA Technology and PCR (Due Friday Mar 28th, 8:30am) 1. There are 3 oligonucleotides shown below. Please calculate the melting temperature (Tm) for each oligo with the following online tool. Use a salt concentration of 50mM and a primer concentration of 0.2μM (1.5 marks): http://www6.appliedbiosystems.com/support/techtools/calc/ A. ATGGTCGTAAACTGAG
Tm=
B. GACGGCGCCGGCGCAC
Tm=
C. GACGGCTTCGGAGGTATGATACGCCG Tm= Looking at the Tm’s of the above oligos, which two factors (other than salt and primer concentrations) affect the Tm of the oligo (1 mark)?
2. A linear piece of DNA was cut with BamHI alone, EcoRI alone and with both BamHI and EcoRI together in three different digests. These digests were separated by agarose gel electrophoresis and the following bands were observed on the gel: BamHI alone: 0.8, 1.0 and 3.5kb EcoRI alone: 2.3 and 3kb BamHI & EcoRI together: 0.8, 1.0, 1.5 and 2kb From this series of digests, draw a restriction map for the linear DNA on the line below. Show the location of all enzyme cut sites and the distances between them clearly (2 marks). Please note, more than one interpretation may be possible from these results. Just show one.
3. Purified bacteriophage lambda DNA digested with HindIII can be used as a cheap DNA marker for gel electrophoresis. The picture below shows such a digest on an agarose gel (lane 2). On semi-log graph paper (see MyLearningSpace), please draw a neat standard curve for these markers on this gel. Using the standard curve, determine the size of the DNA fragments running in lane 1 at positions A, B and C (4.5 marks—0.5 marks for neatness). Please note, the graph MUST be hand drawn with pencil and clearly labeled showing the markers and the three unknown markers (A,B and C). No photocopies, or computer generated graphs will be accepted.
4. The diagram below outlines a molecular test to determine if individuals have the sickle-cell allele. First the region is amplified by PCR and then digested with a restriction enzyme. The two primers are located just to the left of the “1” site and just to the right of the “3” site.
a. If the distance between site 1 and 2 is 250bp and the distance between site 2 and 3 is 500bp, then show what the gel would look like when the PCR product is cut with the restriction enzyme (show the bands in the empty gel above for people who are homozygous and heterozygous for these alleles)(2marks). b. Which particular restriction enzyme is used for this RFLP analysis? How can this enzyme differentiate between individuals who have the wild type allele and the sickle cell allele (show the two different sequences)(2 marks)?
5. Below is an STR profile for four loci: D8S1179, D21S11, D7S820 and CSF1P0. In the figure below, the upper panel shows all of the identified alleles in the human population (eg. the D8S1179 locus has 12 different alleles) and the lower panel shows the STR profile of John Doe for these 4 loci.
a. What is the chance that someone else in the population has the same profile as John (1 mark)? b. How many different gametes can John produce with respect to these 4 STR loci (1 mark)?
6. Which of the following are potential restriction enzyme sites (circle candidates)(2 marks)? a. 5’-aggcct
b. 5’-ttataa
c. 5’-gaccag
d. 5’-ttaatt
7. Answer the following short questions: a. Which type of blot involves the transfer of DNA separated on a gel and then probed with a nucleic acid probe (1 mark)? b. Which gene is amplified in STR profiling to differentiate between males and females (1 mark)? c. List 2 hurdles that have to be overcome to express a human gene in a bacterial cell (in other words, once you get the gene cloned into a plasmid and insert it into a bacterial cell, why might you have problems getting a protein product) (1 mark)?
d. Which enzyme is used during the creation of a cDNA library to make a DNA copy of the mRNA (1 mark)? e. If you start with 10 DNA molecules in a PCR reaction (the template), how many molecules of the template will be present after 5 cycles of PCR (1 mark)?
8. You have 4 primers that can be used for PCR amplification of a 3000 bp plasmid. The locations of the 5’-end of each 20-nucleotide primer is shown in the diagram below. What will be the size of the PCR product when the following pairs of primers are used together in the PCR reaction (if no product will form, write-in 0 bp) (4 marks):
Name:_______________ Student #: ____________Time of Tut.: ____
Problem Set 5: Recombinant DNA Technology and PCR (Due Friday Mar 28th, 8:30am) 1. There are 3 oligonucleotides shown below. Please calculate the melting temperature (Tm) for each oligo with the following online tool. Use a salt concentration of 50mM and a primer concentration of 0.2μM (1.5 marks): http://www6.appliedbiosystems.com/support/techtools/calc/ A. ATGGTCGTAAACTGAG
Tm=
B. GACGGCGCCGGCGCAC
Tm=
C. GACGGCTTCGGAGGTATGATACGCCG Tm= Looking at the Tm’s of the above oligos, which two factors (other than salt and primer concentrations) affect the Tm of the oligo (1 mark)?
2. A linear piece of DNA was cut with BamHI alone, EcoRI alone and with both BamHI and EcoRI together in three different digests. These digests were separated by agarose gel electrophoresis and the following bands were observed on the gel: BamHI alone: 0.8, 1.0 and 3.5kb EcoRI alone: 2.3 and 3kb BamHI & EcoRI together: 0.8, 1.0, 1.5 and 2kb From this series of digests, draw a restriction map for the linear DNA on the line below. Show the location of all enzyme cut sites and the distances between them clearly (2 marks). Please note, more than one interpretation may be possible from these results. Just show one.
3. Purified bacteriophage lambda DNA digested with HindIII can be used as a cheap DNA marker for gel electrophoresis. The picture below shows such a digest on an agarose gel (lane 2). On semi-log graph paper (see MyLearningSpace), please draw a neat standard curve for these markers on this gel. Using the standard curve, determine the size of the DNA fragments running in lane 1 at positions A, B and C (4.5 marks—0.5 marks for neatness). Please note, the graph MUST be hand drawn with pencil and clearly labeled showing the markers and the three unknown markers (A,B and C). No photocopies, or computer generated graphs will be accepted.
4. The diagram below outlines a molecular test to determine if individuals have the sickle-cell allele. First the region is amplified by PCR and then digested with a restriction enzyme. The two primers are located just to the left of the “1” site and just to the right of the “3” site.
a. If the distance between site 1 and 2 is 250bp and the distance between site 2 and 3 is 500bp, then show what the gel would look like when the PCR product is cut with the restriction enzyme (show the bands in the empty gel above for people who are homozygous and heterozygous for these alleles)(2marks). b. Which particular restriction enzyme is used for this RFLP analysis? How can this enzyme differentiate between individuals who have the wild type allele and the sickle cell allele (show the two different sequences)(2 marks)?
5. Below is an STR profile for four loci: D8S1179, D21S11, D7S820 and CSF1P0. In the figure below, the upper panel shows all of the identified alleles in the human population (eg. the D8S1179 locus has 12 different alleles) and the lower panel shows the STR profile of John Doe for these 4 loci.
a. What is the chance that someone else in the population has the same profile as John (1 mark)? b. How many different gametes can John produce with respect to these 4 STR loci (1 mark)?
6. Which of the following are potential restriction enzyme sites (circle candidates)(2 marks)? a. 5’-aggcct
b. 5’-ttataa
c. 5’-gaccag
d. 5’-ttaatt
7. Answer the following short questions: a. Which type of blot involves the transfer of DNA separated on a gel and then probed with a nucleic acid probe (1 mark)? b. Which gene is amplified in STR profiling to differentiate between males and females (1 mark)? c. List 2 hurdles that have to be overcome to express a human gene in a bacterial cell (in other words, once you get the gene cloned into a plasmid and insert it into a bacterial cell, why might you have problems getting a protein product) (1 mark)?
d. Which enzyme is used during the creation of a cDNA library to make a DNA copy of the mRNA (1 mark)? e. If you start with 10 DNA molecules in a PCR reaction (the template), how many molecules of the template will be present after 5 cycles of PCR (1 mark)?
8. You have 4 primers that can be used for PCR amplification of a 3000 bp plasmid. The locations of the 5’-end of each 20-nucleotide primer is shown in the diagram below. What will be the size of the PCR product when the following pairs of primers are used together in the PCR reaction (if no product will form, write-in 0 bp) (4 marks):
