The archaeal Hjm helicase has recQ-like functions, and may be involved in repair of stalled replication fork
R Original 12 11 Functions Fujikane Article ofetPublishing archaeal al. Hjm Blackwell Malden, Genes GTC © ?1365-2443 2006 Blackwell toUSA Cells Publishing Inc Ltdhelicase
Ryosuke Fujikane1, Hideo Shinagawa2 and Yoshizumi Ishino1,* 1
Department of Genetic Resources Technology, Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Fukuoka-shi, Fukuoka 812-8581, Japan 2 Department of Molecular Microbiology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan
The archaeal Hjm is a structure-specific DNA helicase, which was originally identified in the hyperthermophilic archaeon, Pyrococcus furiosus, by in vitro screening for Holliday junction migration activity. Further biochemical analyses of the Hjm protein from P. furiosus showed that this protein preferably binds to fork-related Y-structured DNAs and unwinds their double-stranded regions in vitro, just like the E. coli RecQ protein. Furthermore, genetic analyses showed that Hjm produced in E. coli cells partially complemented the defect of functions of RecQ in a recQ mutant E. coli strain. These results suggest that Hjm may be a functional counterpart of RecQ in Archaea, in which it is necessary for the maintenance of genome integrity, although the amino acid sequences are not conserved.The functional interaction of Hjm with PCNA for its helicase activity further suggests that the Hjm works at stalled replication forks, as a member of the reconstituted replisomes to restart replication.
Introduction DNA replication and recombinational repair are basic phenomena in living cells. During these processes, DNA strands are converted into various structures, and DNA helicases are essential for all aspects of DNA metabolism. Many reports related to biochemical characterizations of DNA helicases, as well as descriptions of helicase-related human genetic diseases, have been published to date. Helicases are also related to RNA metabolisms including splicing and gene silencing (reviewed in Matson et al. 1994; Singleton & Wigley 2002; Silverman et al. 2003; Tuteja & Tuteja 2004). In the primary structure of a protein, helicase activity can be predicted by a set of wellconserved sequences, called “helicase motifs.”Within the whole genome sequence of Saccharomyces cerevisiae, for example, there are more than 130 open reading frames (ORFs), with helicase motifs in the deduced amino acid sequences (Shiratori et al. 1999). Further sequence comparisons allowed the classification of helicases into five families (Gorbalenya & Koonin 1993).There are two big families, superfamily 1 (SF1) and superfamily 2 (SF2), whose members have seven helicase motifs (motif I, II, Communicated by : Fumio Hanaoka *Correspondence: E-mail:
[email protected] III, IV, V, VI and VII). The motifs I and II are the highly conserved Walker A and B motifs, which are well known as the purine NTP binding site in NTP-catalyzing enzymes (Walker et al. 1982). The other motifs are less conserved and differ between the SF1 and SF2. The structural and functional relationships of the helicases are critical for understanding the molecular mechanisms of DNA transactions in the living cells. Homologous recombination is a very important process for DNA transactions, and several helicases are involved in this procedure.We have been studying DNA transactions in Archaea, the third domain of life, from the aspect of their molecular mechanisms (Uemori et al. 1995; Hayashi et al. 1999; Komori et al. 1999a, 2000a,b,c,d, 2002, 2004; Komori & Ishino 2001; Nishino et al. 2001a,b, 2003, 2005a,b). Archaea share many similarities with Eukarya in their genetic information processing pathways, in terms of the sequences of the involved protein factors (Olsen & Woese 1997). For example, the proteins that participate in the early stage of homologous recombination, such as Mre11, Rad50, RPA, and RadA (Rad51), are common in Eukarya and Archaea (Komori et al. 2000a,b; Komori & Ishino 2001). On the other hand, we found that Hjc, the archaeal endonuclease specific for resolving the Holliday junction intermediate (HJ), shares no sequence homology with any protein from
DOI: 10.1111/j.1365-2443.2006.00925.x © 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Genes to Cells (2006) 11, 99–110
99
R Fujikane et al.
either Eukarya or Bacteria (Komori et al. 1999b, 2000c,d; Nishino et al. 2001a,b), and thus the evolutional relationships of the HJ resolvases are quite interesting (Aravind et al. 2000; Lilley & White 2000). The protein with an activity to cause the branch point of an HJ to migrate is a structure-specific DNA helicase. The RuvB protein has this activity and cooperatively works with RuvA in eubacterial cells (reviewed in Shinagawa & Iwasaki 1996; West 1997). To identify the protein corresponding to the RuvB protein in Archaea, we screened for the target activity in a cell extract from the hyperthermophilic archaeon, Pyrococcus furiosus, using a synthetic HJ as the substrate, and identified a novel structurespecific DNA helicase, Hjm (Holliday junction migration) (Fujikane et al. 2005). Hjm dissociates the RecA-mediated recombination intermediate produced by the plasmid DNA, and unwinds the synthetic HJ, and therefore, the helicase activity of Hjm is probably involved in a late stage of homologous recombination. The amino acid sequence of Hjm, deduced from the cloned gene, revealed that this protein is highly conserved in Archaea, but has no similarity to the bacterial RuvB protein. Further analyses are required to confirm the direct involvement of Hjm in HJ processing in Archaea. The amino acid sequence of Hjm shows that the protein belongs to SF2 helicases, and intriguingly, Hjm shares some sequence similarity with the human Pol Θ, HEL308, and Drosophila Mus308 proteins, which are involved in DNA repair (Fujikane et al. 2005). To gain a better understanding of the physiological functions of Hjm in cells, we performed a detailed investigation of the DNA binding, ATPase, and helicase activities of the Hjm protein. The Hjm helicase showed properties similar to those of E. coli RecQ recently presented by in vitro analyses (Hishida et al. 2004).
RecQ was originally discovered in E. coli as a recombination protein involved in the RecF pathway (Nakayama et al. 1985), and it catalyzes reactions required for the repair of gapped DNA and for the resumption of DNA synthesis after UV-induced DNA damage in the RecF recombination pathway. The RecF pathway is also important to stabilize the nascent strands at stalled forks, to repair the stalled replication forks.Three genetic diseases, Bloom’s,Werner’s, and Rothmund–Thomson syndromes, are now well known to be related to the mutations of human genes, BML, WRN, and RecQ4, which encode proteins homologous to RecQ (reviewed in Bachrati & Hickson 2003; Khakhar et al. 2003). A common feature of these diseases is the enhanced genome instability, which is manifested by high levels of homologous recombination and chromosomal deletions, resulting in a predisposition to cancer.These facts indicate that the RecQ family proteins are important for the maintenance of genome stability in the living cells.To investigate the functions of Hjm in the cells, a complementation test was done using a recQ mutant E. coli. This genetic analysis suggested that Hjm may be a functional counterpart of RecQ in the archaeal cells.
Results Characterization of ATPase activity of Hjm
Hjm is an SF2 helicase family member, as deduced from its sequence, and its structure-specific helicase activity depends on ATP (Fujikane et al. 2005). We analyzed the ATPase of Hjm in more detail, in the presence of DNAs with various structures. As shown in Fig. 1, Hjm has a DNA-dependent ATPase activity with a strength comparable to those of other ATP-dependent helicases. In addition, the Hjm proteins with mutations in the Walker
Figure 1 ATPase activity of wild-type and mutant Hjms. Each protein (40 nm) was incubated with [α-32P]ATP, in a reaction mixture containing 25 mm Tris-HCl, pH 8.0, 5 mm MgCl2, 10 mm (wild-type) or 1 mm (mutant) unlabeled ATP, and 100 µg/mL bovine serum albumin at 55 °C for 0–60 min (left panel).The DNA dependency of the ATPase was also investigated using wild-type Hjm (40 nm) and various formed DNAs (5 nm) in the same reaction condition on the right panel. Products were separated by thin layer chromatography and analyzed with an FLA-5000 imaging analyzer (Fuji Film).
100 Genes to Cells (2006) 11, 99–110
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Functions of archaeal Hjm helicase
Table 1 Sequences of oligonucleotides used to make synthetic substrates Oligonucleotide no. Sequence
Designation
1 2 3 4 5 6 7 8 9 10 11 12 13 14
d27 d22 49N 49R F3–d47 F5–d42 d20 d28 49N2 d30 d17 d20R d18 HSL1
15 16 17
5′ - AGCTATGACCATGATTACGAATTGCTT - 3′ 5′ - AATTCGTGCAGGCATGGTAGCT - 3′ 5′ - AGCTACCATGCCTGCACGAATTAAGCAATTCGTAATCATGGTCATAGCT - 3′ 5′ - AGCTATGACCATGATTACGAATTGCTTAATTCGTGCAGGCATGGTAGCT - 3′ 5′ - AGCTATGACCATGATTACGAATTGCTTGGAATCCTGACGAACTGTAG - 3′ 5′ - GATGTCAAGCAGTCCTAAGGAATTCGTGCAGGCATGGTAGCT - 3′ 5′ - CTACAGTTCGTCAGGATTCC - 3′ 5′ - CTACAGTTCGTCAGGATTCCAAGCAATT - 3′ 5′ - AGCTACCATGCCTGCACGAATTCGTATCAGCGTAATCATGGTCATAGCT - 3′ 5′ - AATTGCTTAATTCGTGCAGGCATGGTAGCT - 3′ 5′ - AGCTATGACCATGATTA - 3′ 5′ - CCTTAGGACTGCTTGACATC - 3′ 5′ - CGTGCAGGCATGGTAGCT - 3′ 5′ - GTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGA AACGCGCGAGACGAAAGG - 3′ 5′ - CCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGGC CAGCCCCCGACACCCGCCA - 3′ 5′ - TGGCGGGTGTCGGGGCTGGCCATGTGTCAGAGGTTTTCACCGTCATCACCCG CCGGGCAAGAGCAACTCG - 3′ 5′ - CGAGTTGCTCTTGCCCGGCGGGTGATGACGGTGAAAACCTCTGACACATGCA GCTCCCGGAGACGGTCAC - 3′
HSL2 HSL3 HSL4
Single-stranded DNA (ssDNA, 3). Double-stranded DNA (dsDNA, 3+4). Y-structured DNA (PY, 3+5). Fork-structured DNA (FI, 2+3+5+7, FRG, 2+5+8+9; FLG, 3+6+11+12). Four-way junction DNA (HSL, 14+15+16+17).
A (K52A) and B (D145A and E146A) motifs lost most of the activity (about 100-fold decreased). Since Hjm was identified as a HJ unwinding helicase from the cell extracts of P. furiosus (Fujikane et al. 2005), we predicted that its ATPase activity would be most stimulated by HJstructured DNA, rather than other structures. Various structured DNAs, single-stranded DNA (ssDNA; 49N), double-stranded DNA (dsDNA; 49N+49R), Y-formed DNA (PY), fork DNA (FI; d22 + 49N + F3-d47 + d20), primed DNA (priDNA; d27 + 49N), and HJ DNA (HLS; HLS1 + HLS2 + HLS3 + HLS4), were prepared by the combinations of oligonucleotides shown in Table 1.Among these DNAs, however, the stimulation efficiencies were not so very different. The linear ssDNA and dsDNA stimulated the ATPase activity of Hjm to a greater extent than the other structures.The fork-structured DNA was the most effective among the branched DNAs. These results led us to investigate the direct binding preference of the Hjm protein in terms of the DNA structure. Comparison of the binding affinities of Hjm to various DNA structures
To further characterize Hjm, a gel mobility shift assay was performed to compare the binding affinities of Hjm to different types of DNA structures. Like the results of
the stimulation efficiency of the ATPase activity, binding preference of Hjm was not drastically distinct among the DNA substrates (Fig. 2). Shifted bands should correspond to DNA-Hjm complex. Multiple shifted bands were observed in the gel shift assay. It is not easy to assign each band at this stage. Slower migrating complexes were observed with increasing concentrations of Hjm in all kinds of DNA substrates, and therefore, Hjm may bind DNA nonspecifically at higher concentrations. To compare the affinities of Hjm to various DNAs quantitatively, the apparent binding constants (Kd values) were calculated from the images of the gel shift assay, in which all the shifted bands were dealt with protein-Hjm complex. A conclusive observation was that Hjm preferably bound DNAs having a single-stranded region (Fig. 2H). Hjm bound HJ as we predicted; however, the affinity was not so strong as compared with normal duplex DNA. The fork-structured DNA showed slightly stronger affinity for Hjm binding as compared to HJ DNA. Among the fork-like structures (Fig. 2D–F), DNAs containing a single-stranded region have a higher affinity. The forked DNA with a gap on the leading strand was more preferable than the forked DNA containing a gap on the lagging strand for Hjm binding (Fig. 2E,F), as observed in E. coli RecQ binding assays, although the difference of the affinities for the two
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Genes to Cells (2006) 11, 99–110
101
R Fujikane et al.
Figure 2 Binding activity of Hjm to various DNA structures.Various concentrations (0, 10, 20, 50, 100, and 200 nm) of the Hjm protein were incubated with DNA bearing each indicated structure. The protein-DNA complexes were analyzed by 6% PAGE and visualized with the imaging analyzer. (A) 49 mer of ssDNA (49N). (B) 49 bp of dsDNA (49N + 49R). (C) Y-structured DNA (PY). (D) Forkstructured DNA (FI). (E) Fork-structured DNA with leading gap (FRG). (F) Fork-structured DNA with a lagging gap (FLG). (G) Four-way junction DNA (HLS). (H) Apparent dissociation constants (Kd) were calculated from three independent experiments for each substrate.
substrates was not so high as compared with the case of RecQ. From these results, we predicted that branched DNA containing single-stranded regions may be the target substrate for Hjm in the cells. The DNA binding preference of Hjm did not perfectly correspond to the stimulation efficiency of the ATPase activity of Hjm. Further investigations are required to address the activation mechanism of the ATPase of Hjm. Characterization of the Hjm helicase
We reported previously that Hjm has the ability to unwind synthetic HJs (Fujikane et al. 2005). However, fork-structured DNA is more preferable for binding of Hjm by the results described above. Therefore, in this study, an in vitro helicase assay was carried out, using a fork-structured DNA as a substrate. To keep a forkstructured DNA at higher temperature, DNAs with 70 nucleotides (HJ1 and HJ2 as described in Komori et al. 1999b) were used (Fig. 3A). Each strand of the synthetic fork-structured DNA was labeled with 32P for the helicase assays. Hjm dissolved the fork-structures in a preferred 102 Genes to Cells (2006) 11, 99–110
order. The strand corresponding to the nascent lagging strand in the fork-structure was most effectively dissociated from the other parts of the fork (the right panels of Fig. 3A,B).The template duplex was separated to a lesser extent (the middle panels of Fig. 3A,B). A very small amount of the unwound product was observed in the case of the DNA strand corresponding to the nascent leading strand (the left panels of Fig. 3A,B). To investigate whether any base composition bias is there among the three branches of the fork-structured DNA, DNAs with different sequences were used for the helicase assay. All of the substrates showed that the strand corresponding to the nascent lagging strand was most effectively dissociated. As shown in Fig. 3B, the preferred unwinding order of the Hjm helicase was also clearly observed. The unwinding direction of the Hjm helicase was investigated by a simple helicase assay using a DNA with a singlestranded region at either the 5′-end or 3′-end as the substrate. As shown in Fig. 4, Hjm clearly unwinds the DNA strand in the 3′ to 5′ direction. This property is also the same as RecQ, and therefore, we predicted that Hjm may unwind the template DNA to create a
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Functions of archaeal Hjm helicase
Figure 3 The Hjm protein preferentially unwinds the lagging strand of fork-structured DNA. (A) Hjm (10 nm) was incubated with 10 nm of 32P-labeled synthetic fork-structured DNA consisting of HJ1, HJ2 (Komori et al. 1999b), and the two other oligonucleotides with complementary sequences with 34 nucleotides long (HJ3-36 and HJ4-36), in the reaction mixture as described in the Experimental procedures at 55 °C. (B) The fork-structured DNA, FI, was used as a substrate to investigate the influence of base sequence on the helicase activity of Hjm.The FI have base-pairs with only 20 nucleotides, and therefore, the reaction temperature was decreased to 37 °C to keep the stable fork structure. The reactions were stopped at 0–30 min by phenol extraction. The products were separated by PAGE and visualized by autoradiography. The labeling position in each substrate is indicated by an asterisk. Lane B indicates the unwound product (positive control) produced by boiling the substrate.
Figure 4 Direction of the Hjm helicase. Various concentrations of Hjm (0, 5, 10, 30, 50, 100 and 200 nm) were incubated with each 32P-labeled DNA substrate with the structures indicated on the top. The labeling position in each substrate is indicated by an asterisk. The reactions were stopped by phenol extraction, and the deproteinized products were separated by 12% PAGE and visualized by autoradiography.
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Genes to Cells (2006) 11, 99–110
103
R Fujikane et al.
single-stranded region upstream of the 5′-end of the nascent lagging strand, when its 5′-end is located at the junction point in the fork-structured DNA as discussed earlier (Hishida et al. 2004). Hjm has a function of RecQ in the E. coli dnaE mutant cells
The properties of the Hjm helicase in vitro, in terms of substrate specificity, clearly resemble those of E. coli RecQ helicase, as we reported recently (Hishida et al. 2004). Therefore, we tried a genetic complementation experiment using E. coli strains. The dnaE gene encodes the α subunit of the replicative DNA polymerase (PolIII), and the cells carrying a temperature-sensitive
mutation in this gene (dnaE486; S885P mutation) induce the SOS response and become filamented at 38 °C, a semirestrictive temperature that causes a severe growth defect. It is known that a ∆recQ mutation can suppress the growth defect of E. coli dnaE486 at 38 °C caused by the induction of the SOS response and the filamentation of the cells (Hishida et al. 2004). These genetic studies indicated that the RecQ protein plays a role in stalling the growth of PolIII mutant cells at 38 °C. To investigate the RecQ-like functions of Hjm in the cells, we introduced the hjm gene into the E. coli dnaE486 strain, TS1502, and expressed it in the cells. The cell growth was analyzed by spotting serial dilutions of cultures on to LB agar plates. As shown in Fig. 5A, the temperature sensitivity of TS1502 was suppressed by the mutation of
Figure 5 Hjm complements RecQ function in E. coli cells. (A) The E. coli dnaE486 strain has a growth defect at 37.5 °C. Disruption of the recQ gene suppressed the temperature sensitivity of the dnaE486 strain, and the dnaE486 ∆recQ strain shows normal growth at 37.5 °C. E. coli mutant cells carrying the genes episomally, as indicated on the left side of each panel, were serially diluted and spotted on to plates. The plates were incubated at 30 or 37.5 °C (pET, vector; WT, wild-type hjm; K52A, K52A mutant hjm; D145A, D145A mutant hjm; E146A, E146A mutant hjm).The spots included 107, 106, 105, and 104 cells, respectively, from left to right. (B) Morphological analysis of dnaE486 or dnaE486 ∆recQ mutant cells. The E. coli cells were grown to early log phase at 30 °C and then grown for 6 h at 38 °C. The E. coli cells were stained with DAPI and observed under a fluorescence microscope (pHJM; the vector containing hjm gene, pET; pET21d vector).
104 Genes to Cells (2006) 11, 99–110
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Functions of archaeal Hjm helicase
the recQ gene (dnaE486 ∆recQ strain, TS1507). However, when the hjm gene was introduced into TS1507 episomally, the suppression of the temperature sensitive phenotype at 37.5 °C was decreased. When the mutant hjm genes, encoding Hjm with mutations in the Walker A and B motifs (K52A, D145, and E146A), were introduced into TS1507, the growth defect was obviously reduced. These results indicate that the active Hjm protein can partially substitute for RecQ in E. coli cells. The morphological features of the E. coli dnaE486 and dnaE486 ∆recQ cells carrying the hjm gene were also observed at 30 and 38 °C (Fig. 5B). All of the cells grew normally at 30 °C. As shown previously (Hishida et al. 2004), the dnaE486 strain was elongated, while in contrast, the dnaE486 ∆recQ cells carrying pET21d were normal or only slightly filamented after a 6 h incubation at 38 °C.The expression of the hjm gene in the dnaE486 ∆recQ strain caused it to become filamented, to the same extent as the dnaE486 strain. These results support the proposal that the Hjm protein produced in the E. coli cells at least partially compensates for the RecQ protein. It is not surprising that the Hjm protein expressed in E. coli cells works at 37 °C, because the purified Hjm protein showed 5 –10% of the helicase activity at 37 °C relative to that at 55 °C in vitro (data not shown). PCNA interacts with Hjm and stimulates the helicase activity
To identify the proteins interacting with Hjm in the cells, in vivo immunoprecipitation analyses were performed using several antisera bound to Protein A Sepharose beads.These experiments revealed that PCNA co-precipitated with Hjm (Fig. 6A). The direct interaction between these proteins was confirmed by a surface plasmon resonance analysis (Fig. 6C). Hjm specifically bound to PCNA anchored on a sensor chip, with a dissociation constant value (Kd) of 2.2 × 10−7 m. The mutant Hjm, in which 20 amino acids from the C-terminus were deleted, did not bind to the PCNA on the chip, under the same conditions (Fig. 6B,C).This result showed that the C-terminal region of Hjm mainly contributes to the interaction with PCNA. To investigate the functional role of this physical interaction, we assayed the helicase activity of Hjm in the presence and absence of PCNA using the same synthetic fork-structured DNA as used in Fig. 3A. As shown in Fig. 6D, PCNA stimulated the helicase activity of Hjm for the fork-structured DNA in the presence of 0.1 m sodium chloride. In contrast, the helicase activity of the mutant Hjm with the C-terminal truncation was not stimulated by the incubation with PCNA (data not shown). It is very interesting that gel images of
the helicase assays in the presence of PCNA were different from those in the absence of PCNA (Figs 3A and 6D). The template duplex was unwound more preferentially than the nascent lagging strand in the fork-structured DNA. PCNA may change the preference of Hjm helicase in unwinding position of the fork-structured DNA. These results suggest that Hjm participates in a repair complex, which can be replaced at the stalled replisome by a PCNA-mediated protein complex.
Discussion Hjm is a DNA structure-specific helicase that we originally identified in archaeal cells by a screen for HJ unwinding activity (Fujikane et al. 2005). In this study, we have shown that the Hjm protein has preferable affinity for fork-structured DNA, especially that containing a single-stranded gap near the junction. Furthermore, the helicase activity of Hjm has a distinct preference for unwinding the DNA strand corresponding to the nascent lagging strand from fork-structured DNA. These biochemical properties of Hjm are very similar to those of the E. coli RecQ protein, as described recently by our group (Hishida et al. 2004). In addition to these biochemical studies, the archaeal Hjm protein produced in E. coli dnaE486 ∆recQ cells was functional, and at least partially complemented their filamented phenotype. These results showed that Hjm is probably involved in stalled replication fork repair, and thus is very important for genome stability in Archaea. It has been curious that most of the archaeal organisms with completed genome sequences do not possess any gene encoding a RecQ-like sequence. In contrast, eukaryotic organisms have RecQ homologs, including Sgs1, Rqh1, BLM, and WRN (reviewed in Bachrati & Hickson 2003; Khakhar et al. 2003). These eukaryotic RecQ family proteins have been characterized, and the fact that three of the five human RecQ homologs, BLM, WRN, and RECQ4, have direct relations to the cancerpredisposing disorders, Bloom’s syndrome, Werner’s syndrome, and Rothmund–Thomson syndrome, respectively, proves the crucial functions of the RecQ family proteins in genome integrity. No archaeal RecQ protein has been previously described, and this is the first report suggesting a RecQ-like function in Archaea. It is important to understand the details of the cellular function of Hjm. In addition, an evolutional comparison of the Hjm structure with those of other helicases would be interesting, because the Hjm sequence shares no homology with those of other RecQ family proteins. We identified Hef (Helicase-associated endonuclease for fork structure) from P. furiosus cell extracts during a
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Genes to Cells (2006) 11, 99–110
105
R Fujikane et al.
Figure 6 Physical and functional interactions between Hjm and PCNA. Total cell extracts of P. furiosus were incubated with anti-Hjm and anti-PCNA antibodies, respectively, which were conjugated with Protein A-Sepharose. The precipitates were analyzed by Western blotting using anti-Hjm and anti-PCNA antibodies. (B) Multiple alignment of the amino acid sequences of the C-terminal regions in the archaeal Hjm orthologs. PF, P. furiosus; PAB, P. abyssi; PH, P. horikoshii; AF, Archaeoglobus fulgidus; HALO, Halobacterium Sp. NRC-1; MM, Methanosarcia mazei; STO, Sulfolobus Tokodaii; PAE, Pyrobaculum aerophilum; SSO, Sulfolobus solfataricus; TA, Thermoplasma acidophilum; APE, Aeropyrum pernix; TVN, T. volcanium; MTH, Methanothermobacter thermoautotrophicus; MJ, Methanocaldococcus jannaschii. (C) SPR analysis of the physical interaction between Hjm and PCNA. Purified recombinant PCNA was immobilized on a BIAcore sensor chip, and incubated with 5, 10, 20, 40 and 60 µg/mL of wild-type Hjm or 100 µg/mL of C-terminal deleted mutant Hjm according to the manufacturer’s recommendations. (D) The fork-structured DNA (made of HJ-1, HJ-2, HJ3-36, and HJ4-36) as used in Figure 3A labeled at asterisked position with 32P with (5 nm) was incubated with 50 nm of Hjm and 0–1000 nm of PCNA, and then 0.1 m NaCl was added to the reaction mixture, as described in the Experimental procedures.The band intensities of the unwound products were quantified with the imaging analyzer, FLA5000 (FUJI FILM), and the helicase activity was calculated by putting two product bands (bearing from unwinding of template duplex or nascent strands) together as the unwound products.
screen for a protein interacting with Hjc, the archaeal HJ resolvase (Komori et al. 1999b), and analyzed its biochemical characteristics (Komori et al. 2002, 2004). Hef consists of a helicase domain and a nuclease domain, and each domain has a specific affinity for branched DNA including a fork-structure. The nuclease domain of Hef shares sequence similarity with those of the XPF/Rad1/ Mus81 nuclease family members, and it cleaves the template 106 Genes to Cells (2006) 11, 99–110
DNA for leading strand synthesis near the junction point in the fork structure. Based on detailed biochemical analyses, we proposed that Hef is involved in stalled replication fork repair with the cooperative effects of the helicase and the endonuclease, to process recombinational repair by converting the fork structure (Komori et al. 2004). The crystal structures of the P. furiosus Hef protein have been determined, and its recognition
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Functions of archaeal Hjm helicase
mechanism for fork-structured DNA has been discussed (Nishino et al. 2003, 2005a,b). Exciting reports have been published very recently describing that a human ortholog of Hef protein is directly related to Fanconi anemia (FA), a genetic disease caused by chromosome instability (Meetei et al. 2005; Mosedale et al. 2005), and physiological functions of Hef have become more interesting. The Hjc protein, an archaeal HJ resolvase, may also be involved in the stalled fork repair to solve the four-way junction produced by fork reversal. We detected the direct interaction between Hjc and PCNA (S. Matsumiya, S. Ishino,T. Nishino, K. Komori,Y. Ishino & K. Morikawa, unpublished observation). Hjc also interacts with RadB, an unknown repair protein (Hayashi et al. 1999). In this study, we suggest that Hjm may also be involved in stalled replication fork repair. We recently proposed that RecQ functions in E. coli cells in resolving the stalled replication fork, where RecQ binds a single-stranded gap on the leading strand, unwinds the double-stranded template DNA ahead of the fork, and then switches to unwinding the lagging strand to expand the singlestranded region.This structural change of the fork DNA induces the SOS response, a bacterial checkpoint system (Hishida et al. 2004).The substrate specificity of the Hjm helicase in vitro suggests that Hjm may have the same function as E. coli RecQ at the stalled fork. In this study, we showed that Hjm physically interacts with PCNA with the same affinity as other PCNA interacting proteins.This interaction has functional meaning, at least for the helicase activity in vitro. Hjm may be introduced into the replisome by PCNA at a stalled replication fork, to convert its structure for restoration. PCNA-Hjm complex may preferentially unwind templete duplex ahead of the fork, and subsequently, the helicase complex switches to the lagging strand and creates an ssDNA region by unwinding nascent lagging strand as we proposed for RecQ function in E. coli. Our preliminary immunoprecipitation showed the possibility of direct interaction between Hjm and RadA, the archaeal RecA, suggesting that RadA is also involved in this process. The previous reports showing direct interaction between WRN protein and PCNA from mouse (Lebel et al. 1999) and human (Huang et al. 2000; Rodriguez-Lopez et al. 2003) are also consistent with the idea that Hjm may be a RecQ-like helicase involved in replication fork repair. We are eager to solve the puzzle of the functions of each protein involved in stalled replication fork repair, to obtain a comprehensive understanding of the molecular mechanisms of this important repair system (Fig. 7). In the case of the stalled fork, in which progression is
Figure 7 Relationships of proteins that may be involved in stalled replication fork repair in Archaea. A model for the roles for Hjm in the stalled replication fork repair is schematically drawn. Hjm may be involved in a repair pathway including homologous recombination without stand break. Hef may cleave the junction point of the forked DNA to lead another homologous recombination process.Translesion synthesis pathway in archaea is not well known yet. Hjc, a HJ resolvase, may function when a four-way junction is formed by fork regression (not shown in this figure). Further unknown protein factors may be discovered from continuous works.
blocked by some lesion on the DNA strand, translesion synthesis (TLS) is the other major repair process. It is also interesting that many archaeal organisms lack proteins with sequence homology to theY family of DNA polymerases, except for Sulfolobus PolY, which has been characterized from both biochemical and structural aspects (Boudsocq et al. 2001; Ling et al. 2001; Silvian et al. 2001; Zhou et al. 2001; Potapova et al. 2002; Shimizu et al. 2003). The molecular mechanism of TLS in archaeal DNA transactions is also an interesting subject. Based on the in vitro properties of Hjm in our previous report, we proposed that Hjm could be a functional counterpart of the eubacterial RuvB protein for the migration of the branch points of HJ intermediates in homologous recombination, although no sequence similarity and also Hjm and RuvB seem to migrate the branch point of HJ with different mechanisms (Fujikane et al. 2005). We will consider the possibility of Hjm as a branch migration protein of HJ through our continuing investigations of the functions of Hjm in archaeal cells. During the preparation of this manuscript, a report describing the characterization of an Hjm homolog from a different archaeon, Methanothermobacter thermoautotrophicus, was published (Guy & Bolt 2005). This report showed that the Hjm homolog (called Hel308a) has E. coli
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Genes to Cells (2006) 11, 99–110
107
R Fujikane et al.
RecQ-like functions in vivo using exactly the same Experimental procedures employed in this study (the E. coli strains were provided by our group). The in vitro properties of the Hel308a helicase are also quite similar to those of P. furiosus Hjm, as described in this study. These two studies, using the genes and proteins from P. furiosus and M. thermoautotrophicus are consistent, at least in terms of the RecQ-like functions of these proteins in archaeal cells.
Experimental procedures DNA substrates
The purified Hjm protein was incubated with 5 nm of 32P-labeled synthetic DNA substrates, in a reaction buffer containing 10 mm Tris-HCl, pH 8.0, 10 mm ATP, 5 mm MgCl2, and 50 µg/mL BSA, at 55 °C or 37 °C. The products were separated by 12% polyacrylamide gel electrophoresis (PAGE) with TAE buffer (10 mm Tris-acetate, pH 7.9, and 1 mm EDTA), and the electrophoretic profiles were visualized by autoradiography. To investigate the effect of PCNA on the Hjm helicase activity for fork-structured DNA, NaCl was added to the reaction mixture to see the effect of PCNA more clearly as the case of P. furiosus DNA polymerase as reported previously (Ishino et al. 2001).
Gel mobility shift assay
Oligonucleotides to construct DNA substrates with various structures are listed in Table 1. Combinations of oligonucleotides for each structure were also shown in Table 1. All DNA substrates were prepared by annealing the appropriate oligonucleotides for each structure as described earlier (Komori et al. 1999b).
Preparation of Hjm protein The recombinant Hjm protein was prepared as previously described (Fujikane et al. 2005). Briefly, to obtain the recombinant Hjm protein, E. coli BL21 codonPlusTM (DE3)-RIL cells (Stratagene) carrying pHJM were grown in 1 L of LB medium containing 50 µg/mL ampicillin and 34 µg/mL chloramphenicol at 37 °C. The cells were cultured to an OD600 of 0.35, and the expression of the gene was induced by 1 mm IPTG for 5 h at 37 °C. After cultivation, the cells were harvested and disrupted by sonication in buffer A, containing 50 mm Tris-HCl, pH 8.0, 0.5 m NaCl, 0.5 mm EDTA, 1 mm DTT, and 10% glycerol. After centrifugation (12 000 g, 15 min), the soluble fraction was incubated at 80 °C for 20 min. The heat-resistant fraction was treated by 0.15% polyethylenimine to precipitate the nucleic acids. The soluble proteins were precipitated by 80%-saturated ammonium sulfate. The precipitated proteins were resuspended in buffer B, containing 50 mm Tris-HCl pH 8.0, 0.5 m NaCl, 1.25 m (NH4)2SO4, 0.5 mm EDTA, 1 mm DTT, and 10% glycerol, and were fractionated on a HiTrap Butyl column (Amersham Biosciences). The proteins were eluted at 0 m ammonium sulfate and were dialyzed against buffer C, containing 10 mm K-phosphate, 7 mm β-mercaptoethanol, 0.01 mm CaCl2, and 10% glycerol.The dialyzate was loaded on to a CHT-II column (Bio-Rad), and the proteins were eluted at 0.25 – 0.35 m K-phosphate.The eluted proteins were dialyzed against buffer D, containing 50 mm Tris-HCl, pH 8.0, 0.5 mm EDTA, 1 mm DTT, and 10% glycerol, and the dialyzate was fractionated on a MonoQ 5/5 column (Amersham Biosciences). The proteins were eluted at 0.32–0.37 m NaCl. The eluted Hjm fraction was stored at 4 °C. To prepare the mutant Hjm proteins with substitutions in the Walker A (K52A) and B (D145A and E146A) motifs, site-directed mutagenesis was performed, as previously described (Komori et al. 2000c). These mutant proteins were purified using the same procedure as that for the wild-type Hjm, as described above.
108 Genes to Cells (2006) 11, 99–110
Helicase assay
Various concentrations (0–200 nm) of the purified Hjm protein were incubated with 5 nm of 32P-labeled synthetic DNA substrates, in a reaction mixture containing 10 mm triethanolamine, 5 mm MgCl2, 10 mm ATPγS, and 50 µg/mL BSA, at 37 °C for 20 min.The reaction mixtures were fractionated by 6% PAGE and visualized with an FLA5000 image analyzer (FUJIFILM). The apparent dissociation constants (Kd) were calculated as previously described (Komori et al. 1999a).
ATPase assay The purified Hjm protein (40 nm) was incubated in a reaction mixture, containing 10 mm Tris-HCl, pH 8.0, 1 mm ATP, 5 mm MgCl2, 50 µg/mL BSA, and 1 µCi [α-32P]ATP, in the presence or absence of 5 nm of DNA with various structures. The reaction mixtures were incubated at 55 °C for 0, 5, 10, 20, 30 and 60 min. Products were separated by thin-layer chromatography on polyethyleneimine cellulose, using 1 m formic acid and 0.5 m LiCl2 as the running solution.
Complementation test using the E. coli dnaE mutant and the hjm gene The E. coli mutant strains, TS1502 (dnaE486 ) and TS1507 (dnaE486 ∆ recQ), were previously described (Hishida et al. 2004). E. coli cells were grown at 30 °C in LB medium. Ampicillin (50 µg/mL), tetracycline (10 µg/mL), and chloramphenicol (10 µg/mL) were used as needed.Ten-fold serial dilutions of each culture (1 × 108 cells/mL) were spotted on to duplicate LB plates. These plates were incubated at 30 °C and 37.5 °C, respectively.
Morphological analysis of the dnaE486 and dnaE486 ∆recQ strains The E. coli mutants, TS1502 and TS1507 (Hishida et al. 2004), were transformed with pET21d or pHJM100. The transformants were grown at 30 °C to early log phase, and then the cultures were shifted to 38 °C and further incubated for 6 h. After this incubation, the cells were harvested and fixed with methanol. The cells were stained with DAPI (4′, 6,-diamino-2-phenylindole) and the
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Functions of archaeal Hjm helicase morphology was monitored under a fluorescent microscope (Zeiss Axioplan2), as previously described (Ishioka et al. 1998).
Surface plasmon resonance analysis The BIAcore system (BIACORE) was used to study the physical interaction between Hjm and PCNA. Highly purified recombinant PCNA (Cann et al. 1999) was fixed on a Sensor Chip CM5, research grade (BIACORE), according to the manufacturer’s recommendations.To measure the kinetic parameters, various concentrations of Hjm were applied to the immobilized PCNA. All measurements were performed at a continuous flow rate of 2 µL/ min in buffer (10 mm HEPES, pH 7.4, 150 mm NaCl, 3.4 mm EDTA, 0.005% Tween 20). At the end of each cycle, the bound Hjm protein was removed by washing with 10 mm glycine, pH 2.0. The kinetic constants for Hjm binding to PCNA were determined from the association and dissociation curves of the sensorgrams, using the BIAevaluation program (BIACORE).
Acknowledgments We thank S. Kiyonari for the preparation of the P. furiosus PCNA and for assistance with SPR analysis. We also thank T. Hishida for discussions about the genetic analyses. Y. I. was supported by the Human Frontier Science Program (HFSP). This work was also supported in part by Grants-in Aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan to Y. I. and H. S. We acknowledge the Hou-ansha foundation for the support of our work.
References Aravind, L., Makarova, K.S. & Koonin, E. (2000) SURVEY and SUMMARY: holliday junction resolvases and related nucleases: identification of new families, phyletic distribution and evolutionary trajectories. Nucleic Acids Res. 28, 3417–3432. Bachrati, C.Z. & Hickson, I.D. (2003) RecQ helicases: suppressors of tumorigenesis and premature aging. Biochem J. 374, 577–606. Boudsocq, F., Iwai, S., Hanaoka, F. & Woodgate, R. (2001) Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with lesion-bypass properties akin to eukaryotic pol η. Nucleic Acids Res. 29, 4607–4616. Cann, I.K.O., Ishino. S., Hayashi, I., et al. (1999) Functional interactions of a homolog of proliferating cell nuclear antigen with DNA polymerases in Archaea. J. Bacteriol. 181, 6591– 6599. Fujikane, R., Komori, K., Shinagawa, H. & Ishino, Y. (2005) Identification of a novel helicase activity unwinding branched DNAs from the hyperthermophilic archaeon, Pyrococcus furiosus. J. Biol. Chem. 280, 12351–12358. Gorbalenya, A.E. & Koonin, E.V. (1993) Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol. 3, 419 – 429. Guy, C.P. & Bolt, E. (2005) Archaeal Hel308 helicase targets replication forks in vivo and in vitro and unwinds lagging strands. Nucleic Acids Res. 33, 3678 –3690.
Hayashi, I., Morikawa, K. & Ishino, Y. (1999) Specific interaction between DNA polymerase II (PolD) and RadB, a Rad51/ Dmc1 homolog, in Pyrococcus furiosus. Nucleic Acids Res. 27, 4695–4702. Hishida, T., Han, Y.-W., Shibata, T., et al. (2004) Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 18, 1886–1897. Huang, S., Beresten, S., Li, B., Oshima, J., Ellis, N.A. & Campisi, J. (2000) Characterization of the human and mouse WRN 3′→5′ exonuclease. Nucleic Acids Res. 28, 2396–2405. Ishino, Y., Tsurimoto, T., Ishino, S. & Cann, I.K.O. (2001) Functional interactions of an archaeal sliding clamp with mammalian clamp loader and DNA polymerase δ. Genes Cells 6, 699–706. Ishioka, K., Fukuoh, A., Iwasaki, H., Nakata, A. & Shinagawa, H. (1998) Abortive recombination in Escherichia coli ruv mutants blocks chromosome partitioning. Genes Cells 3, 209–220. Khakhar, R.R., Cobb, J.A., Bjergbaek, L., Hickson, I.D. & Gasser, S.M. (2003) RecQ helicases: multiple roles in genome maintenance. Trends Cell Biol. 13, 493–501. Komori, K., Ichiyanagi, K., Morikawa, K. & Ishino, Y. (1999a) PI-PfuI and PI-PfuII, intein-coded homing endonucleases from Pyrococcus furiosus. II. Characterization of the binding and cleavage abilities by site-directed mutagenesis. Nucleic Acids Res. 27, 4175–4182. Komori, K., Sakae, S., Shinagawa, H., Morikawa, K. & Ishino, Y. (1999b) A Holliday junction resolvase from Pyrococcus furiosus: functional similarity to Escherichia coli RuvC provides evidence for conserved mechanism of homologous recombination in Bacteria, Eukarya, and Archaea. Proc. Natl. Acad. Sci. USA 96, 8873–8878. Komori, K., Miyata, T., Daiyasu, H., Toh, H., Shinagawa, H. & Ishino, Y. (2000a) Domain analysis of an archaeal RadA protein for the strand exchange activity. J. Biol. Chem. 275, 33791–33797. Komori, K., Miyata, T., DiRuggiero, J., et al. (2000b) Both RadA and RadB are involved in homologous recombination in Pyrococcus furiosus. J. Biol. Chem. 275, 33782–22790. Komori, K., Sakae, S., Daiyasu, H., et al. (2000c) Mutational analysis of the Pyrococcus furiosus Holliday junction resolvase hjc revealed functionally important residues for dimer formation, junction DNA binding, and cleavage activities. J. Biol. Chem. 275, 40385–40391. Komori, K., Sakae, S., Fujikane, R., Morikawa, K., Shinagawa, H. & Ishino, Y. (2000d) Biochemical characterization of the Hjc Holliday junction resolvase of Pyrococcus furiosus. Nucleic Acids Res. 28, 4544–4551. Komori, K. & Ishino, Y. (2001) Replication protein A in Pyrococcus furiosus is involved in homologous DNA recombination. J. Biol. Chem. 276, 25654–25660. Komori, K., Fujikane, R., Shinagawa, H. & Ishino, Y. (2002) Novel endonuclease in Archaea cleaving DNA with various branched structure. Genes Genet. Syst. 77, 227–241. Komori, K., Hidaka, M., Horiuchi, T., Fujikane, R., Shinagawa, H. & Ishino, Y. (2004) Cooperation of the N-terminal Helicase and C-terminal endonuclease activities of Archaeal Hef protein in processing stalled replication forks. J. Biol. Chem. 279, 53175– 53185.
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Genes to Cells (2006) 11, 99–110
109
R Fujikane et al. Lebel, M., Spillare, E.A., Harris, C.C. & Leder, P. (1999) The Werner syndrome gene product co-purifies with the DNA replication complex and interacts with PCNA and topoisomerase I. J. Biol. Chem. 274, 37795 –37799. Lilley, D.M. & White, M.F. (2000) Resolving the relationships of resolving enzymes. Proc. Natl. Acad. Sci. USA 97, 9351– 9353. Ling, H., Boudsocq, F., Woodgate, R. & Yang, W. (2001) Crystal structure of aY-family DNA polymerase in action: a mechanism for error-prone and lesion-bypass replication. Cell 107, 91–102. Matson, S.W., Bean, D.W. & George, J.W. (1994) DNA helicases: enzymes with essential roles in all aspects of DNA metabolism. Bioessays 16, 13–22. Meetei, A.R., Medhurst, A.L., Ling, C., et al. (2005) A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M. Nature Genet. 37, 958–963. Mosedale, G., Niedzwiedz, W., Alpi, A., et al. (2005) The vertebrate Hef ortholog is a component of the Fanconi anemia tumor-suppressor pathway. Nature Struct. Mol. Biol. 12, 763– 771. Nakayama, K., Irino, N. & Nakayama, H. (1985) The recQ gene of Escherichia coli K12: molecular cloning and isolation of insertion mutants. Mol. Gen. Genet. 200, 266 –271. Nishino, T., Komori, K., Ishinho, Y. & Morikawa, K. (2001a) Dissection of the regional roles of the archaeal Holliday junction resolvase Hjc by structural and mutational analyses. J. Biol. Chem. 276, 35735–35740. Nishino, T., Komori, K., Tsuchiya, D., Ishino, Y. & Morikawa, K. (2001b) Crystal structure of the archaeal holliday junction resolvase Hjc and implications for DNA recognition. Structure 9, 197–204. Nishino, T., Komori, K., Ishinho, Y. & Morikawa, K. (2003) Xray and biochemical anatomy of an archaeal XPF/Rad1/Mus81 family nuclease: similarity between its endonuclease domain and restriction enzymes. Structure 11, 445–457. Nishino, T., Komori, K., Tsuchiya, D., Ishino, Y. & Morikawa, K. (2005a) Crystal structure and functional implications of Pyrococcus furiosus Hef helicase domain involved in branched DNA processing. Structure 13, 143–153. Nishino, T., Komori, K., Ishino, Y. & Morikawa, K. (2005b) Structural and functional analyses of an archaeal XPF/Rad1/ Mus81 nuclease: asymmetric DNA binding and cleavage mechanisms. Structure 13, 1183 –1192. Olsen, G.J. & Woese, C.R. (1997) Archaeal genomics: an overview. Cell 89, 991–994. Potapova, O., Grindley, N.D. & Joyce, C.M. (2002) The
110 Genes to Cells (2006) 11, 99–110
mutational specificity of the Dbh lesion bypass polymerase and its implications. J. Biol. Chem. 277, 28157–28166. Rodriguez-Lopez, A.M., Jackson, D.A., Nehlin, J.O., Iborra, F., Warren, A.V. & Cox, L.S. (2003) Characterisation of the interaction between WRN, the helicase/exonuclease defective in progeroid Werner’s syndrome, and an essential replication factor, PCNA. Mech. Ageing. Dev. 124, 167–174. Shimizu, M., Gruz, P., Kamiya, H., et al. (2003) Erroneous incorporation of oxidized DNA precursors by Y-family DNA polymerases. EMBO Rep. 4, 269–273. Shinagawa, H. & Iwasaki, H. (1996) Processing the Holliday junction in homologous recombination. Trends Biochem. Sci. 21, 107–111. Shiratori, A., Shibata, T., Arisawa, M., Hanaoka, F., Murakami, Y. & Eki, T. (1999) Systematic identification, classification, and characterization of the open reading frames which encode novel helicase-related proteins in Saccharomyces cerevisiae by gene disruption and Northern analysis. Yeast 15, 219–253. Silverman, E., Edwalds-Gilbert, G. & Lin, R.-J. (2003) DExD/ H-box proteins and their partners: helping RNA helicases unwind. Gene 312, 1–16. Silvian, L.F., Toth, E.A., Pham, P., Goodman, M.F. & Ellenberger, T. (2001) Crystal structure of a DinB family error-prone DNA polymerase from Sulfolobus solfataricus. Nature Struct. Biol. 8, 984–989. Singleton, M.R. & Wigley, D.B. (2002) Modularity and specialization in superfamily 1 and 2 helicases. J. Bacteriol. 184, 1819– 1826. Tuteja, N. & Tuteja, R. (2004) Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery. Eur. J. Biochem. 271, 1835–1848. Uemori, T., Sato, Y., Kato, I. & Ishino, Y. (1995) A novel DNA polymerase in the hyperthermophilic archaeon, Pyrococcus furiosus: gene cloning, expression, and characterization. Genes Cells 2, 499–512. Walker, J.E., Saraste, M., Runswick, M.J. & Gay, N.J. (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1, 945–951. West, S.C. (1997) Processing of recombination intermediates by the RuvABC proteins. Annu. Rev. Genet. 31, 213–244. Zhou, B.L., Pata, J.D. & Steitz, T.A. (2001) Crystal structure of a DinB lesion bypass DNA polymerase catalytic fragment reveals a classic polymerase catalytic domain. Mol. Cell 8, 427–437. Received: 19 September 2005 Accepted: 31 October 2005
© 2006 The Author(s) Journal compilation © 2006 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.