The Bacillus subtilis YdfHI two-component system ... - Semantic Scholar
Microbiology (2005), 151, 1769–1778
DOI 10.1099/mic.0.27619-0
The Bacillus subtilis YdfHI two-component system regulates the transcription of ydfJ, a member of the RND superfamily Masakuni Serizawa and Junichi Sekiguchi Department of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, 3-15-1 Tokida, Ueda-shi, Nagano 386-8567, Japan
Correspondence Junichi Sekiguchi [email protected]
Received 13 September 2004 Revised
1 February 2005
Accepted 22 February 2005
The ydfHI genes encode a sensor kinase and a response regulator forming a two-component system. ydfJ is located downstream of ydfHI, and belongs to the RND (resistance-nodulation-cell division) superfamily, which is present in most major organisms. Four genes (secDF, yerP, ydfJ and ydgH) in Bacillus subtilis belong to this family. This study revealed that the YdfHI two-component system regulates ydfJ transcription. A gel shift assay using histidine-tagged YdfI (h-YdfI) showed that it directly binds to the ydfJ promoter region. Moreover, DNase I footprinting analysis revealed a tandem repeat sequence consisting of two conserved 12-mer sequences (GCCCRAAYGTAC) within the h-YdfI-binding site.
INTRODUCTION In micro-organisms, a two-component system is a very important signal transduction system for adaptation to drastic and immediate changes in external or internal environmental conditions. This system is usually composed of a sensor kinase and a response regulator. The sensor kinase monitors some type of signal caused by changes in environmental conditions, and transmits the information to the response regulator via a phosphoryl-transfer reaction. The response regulator is shifted to its active state by the phosphate group received from the sensor kinase, and directly binds to the promoter region of its target genes as a transcriptional regulator (Stock et al., 1995). Twenty-nine adjacent sets of genes encoding the sensor kinase and response regulator are recognized in Bacillus subtilis. The functions of thirteen systems, namely CitST (Yamamoto et al., 2000), ComPA (Msadek et al., 1995), CssSR (Hyyrylainen et al., 2001), DctSR (Asai et al., 2000), DegSU (Msadek et al., 1995), DesKR (Aguilar et al., 2001), PhoRP (Hulett, 1996), ResED (Sun et al., 1996), BceRS (Ohki et al., 2003), YufLM (Doan et al., 2003; Tanaka et al., 2003), LiaRS (Mascher et al., 2004), YxdJK (Joseph et al., 2004) and YycFG (Fukuchi et al., 2000), have been reported. It has been recognized that those systems are necessary for micro-organisms to survive under various conditions. Sixteen other systems may also have certain important functions. Genes regulated by a two-component system tend to be located adjacent to the genes encoding the two-component system. Moreover, there is a close association between the signal that a sensor kinase recognizes and the function of Abbreviation: RND, resistance-nodulation-cell division.
0002-7619 G 2005 SGM
Printed in Great Britain
the regulated genes. For example, BceRS regulates bceAB transcription, and bceAB is located downstream of bceRS. bceAB encodes the subunits of the ABC transporter that expels bacitracin from inside the cell. The transcription of bceAB is induced by BceRS, which is activated by the addition of extracellular bacitracin (Ohki et al., 2003). The same phenomenon is also observed in CitST, CssSR, DctSR and DesKR. We studied the genes that are located adjacent to the 16 unknown two-component systems. Genes associated with substance transport were recognized adjacent to 9 two-component systems (YcbAB, YcbML, YccGH, YclKJ, YdfHI, YesMN, YfiJK, YvcPQ and YvfTU). ABC transporter homologues were recognized adjacent to 6 two-component systems (YcbML, YccGH, YclKJ, YfiJK, YvcPQ and YvfTU). ydfJ is located downstream of ydfHI. YdfJ (724 aa; Mr 76 850) has 12 transmembrane segments, two MMPL (Tekaia et al., 1999) domains and an SS (sterol sensing) domain, and belongs to the RND (resistance-nodulationcell division) superfamily that is present in most major organisms. Most genes assigned to this superfamily encode proteins that catalyse substrate efflux via a H+ antiport mechanism. Members of this family are associated with multidrug resistance, heavy-metal ion export, transport of oligosaccharides, and solvent tolerance (Tseng et al., 1999). However, little is known about noxious compound resistance systems mediated by genes involved in this family in low-G+C Gram-positive bacteria. Therefore, the analysis of genes in the RND superfamily of B. subtilis as a model bacterium is important. In DNA microarray experiments under the overexpression of a response regulator (YdfI), ydfJ is regulated by a YdfHI two-component system (Kobayashi et al., 2001). Moreover, there are some reports of an association between 1769
M. Serizawa and J. Sekiguchi
two-component systems and drug efflux genes (Grkovic et al., 2002). Thus, we were interested in determining the association between the YdfHI two-component system and ydfJ transcription, and also the roles of YdfHI and YdfJ in antibiotic resistance and substance transport. In this analysis, we report the positive regulation of ydfJ transcription mediated by the YdfHI two-component system.
METHODS Bacterial strains, plasmids, primers and culture conditions.
The bacterial strains and plasmids used in this study are listed in Table 1. The primers used are listed in Table 2. The bacterial strains were cultured in LB medium (g l21: yeast extract, 5; polypeptone, 10; NaCl, 5; pH 7?2) at 37 uC. When necessary, ampicillin, spectinomycin or kanamycin was added at final concentrations of 50, 50 and 10 mg ml21, respectively. B. subtilis strains were also grown in Difco sporulation medium (DSM) (Schaeffer et al., 1965). Construction of the spectinomycin-resistance-gene harbouring plasmid. A BamHI–XhoI fragment from plasmid pDG1727
including the spectinomycin resistance gene was ligated into the corresponding sites of pBluescriptII-SK(+) to construct pBlueSPR. Construction of the ydfH ydfI double null mutant. A ydfH ydfI double null mutant was constructed by the PCR ligation method. Fragments DYDFH and DYDFI contained the 59-end sequence of ydfH and the 39-end sequence of ydfI, respectively. These fragments were amplified from B. subtilis 168 chromosomal DNA, and the primers YDFH-BF1 and YDFH-R1, and YDFI-F2 and YDFI-XR2, respectively. Fragment SPR was amplified from plasmid pBlueSPR, containing the spectinomycin resistance gene, and the primers
PB-M13Rev and PB-M13-20. The 59-end sequences of YDFH-R1 and YDFI-F2 are complementary to PB-M13-20 and PB-M13Rev, respectively. Fragment YDFHI-SPR was amplified from a mixture of fragments DYDFH, DYDFI and SPR, and the primers YDFH-BF1 and YDFI-XR2. Fragment YDFHI-SPR was used for the transformation of B. subtilis 168, and the ydfHI null mutant YDFHIDSp was selected on an agar plate containing spectinomycin. Construction of the ydfJ disruptant. A ydfJ internal fragment amplified from 168 chromosomal DNA and the primers YDFJ-FE and YDFJ-RB was digested with EcoRI and BamHI. Then the digested fragment was ligated into the EcoRI and BamHI sites of pMUTIN4, and Escherichia coli JM109 was transformed with the ligation mixture to produce pM4YDFJ. Subsequently, YDFJDPM4 was constructed by Campbell-type integration of the plasmid DNA prepared from E. coli C600 cells harbouring pM4YDFJ. The proper integration of the plasmid was confirmed by PCR. Construction of a plasmid for producing 6¾His-tag-fused YdfI in E. coli. For the overproduction and purification of the
66His-tag-fused response regulator YdfI in E. coli, the expression plasmid pQEYDFI was constructed. A 680 bp PCR fragment obtained with the primers YDFI-HisFB and YDFI-HisRP was digested with BamHI and PstI, followed by ligation into the corresponding sites of plasmid pGEM-3Zf(+). E. coli JM109 cells were transformed with the ligation mixture to produce pGYDFI. The nucleotide sequence was confirmed with a DNA sequencer (ABI Prism 310 Genetic Analyser; Applied Biosytems). A BamHI–PstI fragment of pGYDFI including ydfI was ligated in the corresponding sites of the histidine-tagged plasmid pQE-30. The resultant plasmid pQEYDFI was used for the transformation of E. coli M15 harbouring the plasmid pREP4. Consequently, the synthesis of the histidine-tagged YdfI (h-YdfI) was controlled by IPTG induction.
Table 1. Bacterial strains and plasmids Strain or plasmid B. subtilis 168 YDFHIDSp YDFJDPM4 E. coli JM109 C600 M15 Plasmid pGEM-3Zf(+) pBluescriptII-SK(+) pDG1727 pREP4 pQE30 pMUTIN4 pBlueSPR pGYDFI pQEYDFI pDG148ydfI pM4YDFJ
Relevant genotype
Source or reference*
trpC2 trpC2 ydfHI : : spc trpC2 ydfJ : : pM4YDFJ
S. D. Ehrlich This study This study
recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi-1 D(lac–proAB) /F9(traD36 proAB+ lacIq lacZDM15) supE44 hsdR17 thi-1 thr-1 leuB6 lacY1 tonA21 Nals Strs Rifs lac ara gal mtl F2 recA+ uvr+
Takara Bio Laboratory stock Qiagen
bla lacZ bla lacZ bla spc lacI neo bla erm bla lacZ lacI Pspac bla spc bla ydfI bla ydfI bla kan ydfI pMUTIN4 : : DydfJ
Promega Stratagene BGSC Qiagen Qiagen Vagner et al. (1998) This study This study This study Kobayashi et al. (2001) This study
*BGSC, Bacillus Genetic Stock Center, Ohio State University, Columbus, USA; S. D. Ehrlich, INRA, Jouy-en-Josas, France. 1770
Microbiology 151
The YdfHI system regulates ydfJ transcription
Table 2. Primers Primer YDFH-BF1 YDFH-R1 YDFI-F2 YDFI-XR2 PB-M13-20 PB-M13Rev YDFH-FE YDFH-RB YDFI-FE YDFI-RB YDFJ-FE YDFJ-RB YFKC-FE YFKC-RB YDFJP-F YDFJP-R YDFI-HisFB YDFI-HisRP YDFJ-PEX PET-T7
Sequence (5§R3§)* gcgcGGATCCTTACTCACATGATAGGCGG CACTGGCCGTCGTTTTACATACGCCGAATTTATGACCA CATGGTCATAGCTGTTTCCGGATATCTGTTAAAAGATACG gccgCTCGAGTTGTCTATTGTCAGAATACCT GTAAAACGACGGCCAGTG GGAAACAGCTATGACCATG gcgcGAATTCTTACTCACATGATAGGCGG GTAATACGACTCACTATAGGGCGGATCCTCTGTCTGCCATTCCTATAA gcgcGAATTCCGTTGATGACCATCTTGTC GTAATACGACTCACTATAGGGCGGATCCTCTGATGGCTGCATCCATT gcgcGAATTCATGGGTTGCTCGCAATCG GTAATACGACTCACTATAGGGCGGATCCGACTTGCAATCGAGTCAAC gcgcGAATTCTCGTCGATATTCTCCTCGT GTAATACGACTCACTATAGGGCGGATCCTATCTTGCCGAAATCATGCA gcgcgcCTGCAGGAATTCATTGCCATGCAAAAAGGTATT gcgccgCAATTGGTCGACTGACATGATAATCTCCTTTCA gccgGGATCCAATAAGGTTTTAATCGTTGATG gcgcCTGCAGGGCAATTTTCAAATATGCAGT GATCCACGCACATATTGCT TAATACGACTCACTATAGGG
Restriction enzyme BamHI
XhoI
EcoRI BamHI EcoRI BamHI EcoRI BamHI EcoRI BamHI PstI, EcoRI MunI, SalI BamHI PstI
*The additional sequences (lower case), restriction sites (underlined) and T7 RNA polymerase recognition sequences (bold italics) are indicated. Transformation of E. coli and B. subtilis. This was performed
as described previously (Ishikawa et al., 1998). Northern blot analysis. Total RNA preparation and purification were performed as described by Serizawa et al. (2004). The Northern blot analysis of RNAs fractionated by electrophoresis in agarose– formaldehyde gels was performed as described by Ishikawa et al. (1998). The transfer of RNAs onto nylon membranes was performed with a vacuum blotter (model BS-31; Bio Craft). Probe labelling was performed with a DIG RNA labelling kit (Roche Diagnostics) according to the manufacturer’s instructions, but with some minor modifications. Templates for the ydfH-, ydfI-, ydfJ- and yfkC-specific probes were constructed by PCR. ydfH-, ydf-I, ydfJ- and yfkCinternal fragments were amplified from B. subtilis 168 chromosomal DNA, and the primers YDFH-FE and YDFH-RB, YDFI-FE and YDFI-RB, YDFJ-FE and YDFJ-RB, and YFKC-FE and YFKC-RB, respectively. The 59-end sequences of YDFH-RB, YDFI-RB, YDFJRB and YFKC-RB contain the sequence of the T7 RNA polymerase recognition site. The amplified fragments were digested with EcoRI, and then used as templates for in vitro run-off transcription with T7 RNA polymerase. Hybridization and detection were performed with a DIG luminescent detection kit (Roche Diagnostics), according to the manufacturer’s instructions. Primer extension analysis. This was performed as described previously (Yoshida et al., 1997). Total RNA (40 mg) was hybridized
with a primer YDFJ-PEX that had been labelled at the 59-end using T4 polynucleotide kinase (Megalabel kit, Takara Bio) and [c-32P]ATP (Amersham Biosciences). Unincorporated [c-32P]ATP was removed using a MicroSpin S200HR column (Amersham Biosciences). Primer extension reactions were performed with Molony murine leukaemia virus reverse transcriptase (Reverse transcriptase M-MLV; Takara Bio). Dideoxy sequence ladders for use as size markers were prepared with the Takara taq cycle sequencing kit (Takara Bio). Overexpression and purification of h-YdfI. E. coli M15
harbouring pREP4 and pQEYDFJ was cultured in 500 ml LB medium http://mic.sgmjournals.org
containing ampicillin (50 mg ml21), kanamycin (20 mg ml21) and glucose (1 %, w/v) until the cell density reached approximately OD600 0?6 at 37 uC. Then, IPTG was added to the culture at a final concentration of 1 mM, followed by further incubation for 1?5 h. The culture was centrifuged and the pellet was resuspended in 10 ml 10 mM imidazole-NPB solution [10 mM imidazole and 1 M NaCl in 20 mM sodium phosphate buffer (pH 7?4)]. After ultrasonication, the suspension was centrifuged, and the supernatant was filtered through a 0?45 mm membrane filter (DISMIC-13CP cellulose acetate 0?45 mm; Advantec), and applied onto a HiTrap chelating column (1 ml; Amersham Biosciences). The column was washed with 20 ml 10 mM imidazole-NPB solution, and the h-YdfI protein was then eluted with NPB solution containing a stepwise gradient of imidazole, from 20 to 500 mM. The calculated molecular mass of h-YdfI was 25 212 Da. The purified h-YdfI protein was dialysed in PD buffer [40 mM Tris/HCl (pH 7?2) containing 6 mM MgCl2, 1 mM DTT, 50 mM KCl, 0?5 mM CaCl2, 10 % (v/v) glycerol, 200 mM NaCl, 20 mM imidazole] using a dialysis membrane (size 18; Wako). Preparation of radioactively labelled DNA probes for gel shift assay and DNase I footprinting analysis. The probes
YDFJ-Pc and YDFJ-Pn are 39-end radioactively labelled probes of the coding and noncoding strands of the ydfJ upstream region, respectively. The probe PG3-MCS was used as a negative control in the gel shift assay. To construct YDFJ-Pc and YDFJ-Pn, a 196 bp DNA fragment containing the ydfJ promoter region was amplified from B. subtilis 168 chromosomal DNA, and the primers YDFJP-F and YDFJP-R. For the construction of PG3-MCS, a 135 bp fragment was amplified from pGEM-3Zf(+), and the primers PET-T7 and PB-M13Rev. These fragments were purified with a QIAquick gel extraction kit (Qiagen). YDFJ-Pc, YDFJ-Pn and PG3-MCS were digested with EcoRI and SalI, PstI and MunI and EcoRI, respectively. Accordingly, 170, 182 and 113 bp fragments were obtained. Five picomoles each of YDFJ-Pc, YDFJ-Pn and PG3-MCS DNAs were labelled by incubation at 10 uC for 1 h with 1?85 MBq [a-32P]dATP 1771
M. Serizawa and J. Sekiguchi (Amersham Biosciences) and 3 U of the Klenow fragment of DNA polymerase I (Takara Bio). Unincorporated nucleotides were removed using a MicroSpin S400HR column (Amersham Biosciences). The fragments were then ethanol precipitated, and the pellet was dissolved in 100 ml sterilized ultrapure water. The YDFJ-Pc, YDFJ-Pn and PG3MCS DNAs were digested with SalI, PstI and EcoRI, respectively. After incubation at 37 uC for 6 h, the restriction enzymes were completely removed with Micropure-EZ (Millipore) and the DNA was ethanol precipitated. The pellets were dissolved in 200 ml sterilized ultrapure water at a final concentration of 0?025 pmol ml21. Gel shift assay. Radioactively labelled YDFJ-Pc and PG3-MCS
DNAs were used. Binding reactions were performed with a fixed amount of probe DNA (0?025 pmol), 4 mg of poly(dI-dC) (Amersham Biosciences) and different amounts of h-YdfI (0, 6?25, 12?5, 18?75 and 25 pmol) at 20 uC for 1 h in GB buffer [40 mM Tris/HCl (pH 7?2) containing 6 mM MgCl2, 1 mM DTT, 50 mM KCl, 0?5 mM CaCl2, 10 % (v/v) glycerol, 200 mM NaCl, 20 mM imidazole, 1 % (v/v) Tween 20] in 20 ml total volume. Two microlitres of loading dye [0?2 % (w/v) bromophenol blue, 0?1 % (w/v) xylene cyanol, 40 % (v/v) glycerol, 60 % (v/v) TBE buffer diluted to one fourth (TBE buffer: 50 mM Tris, 48?5 mM boric acid, 2 mM EDTA)] was added to each reaction mixture, and the samples were loaded onto an 8 % native polyacrylamide gel [the ratio of acrylamide to bisacrylamide was 75 to 1 (w/w)]. The competition assay was performed with a fixed amount of radioactively labelled YDFJPc (0?025 pmol), different amounts of non-labelled YDFJ-Pc (2?5, 5, 7?5 and 10 pmol), 4 mg poly(dI-dC), and a fixed amount of h-YdfI (25 pmol) at 20 uC for 1 h in GB buffer in a total volume of 20 ml. DNase I footprinting analysis. Radioactively labelled YDFJ-Pc
(coding strand) and YDFJ-Pn (noncoding strand) were used in this analysis. Binding reactions were performed with a fixed amount of radioactive probe (0?125 pmol), 20 mg poly(dI-dC) and different amounts of h-YdfI (0, 62?5, 125, 187?5 and 250 pmol) at 20 uC for 1 h in GB buffer in 100 ml total volume. Subsequently, 1 ml DNase I solution (3 units ml21; Takara Bio) was added to each reaction mixture, followed by incubation for 1 min at 20 uC. DNase I digestion was terminated by the addition of 100 ml ice-cold DNase I stop solution [1?5 M sodium acetate (pH 5?2) containing 0?02 M EDTA, 0?02 mg ml21 sonicated salmon sperm DNA (Stratagene)], and then the mixture was subjected to phenol/chloroform/isoamyl alcohol (25 : 24 : 1, by vol.) extraction and ethanol precipitation. The pellet was dissolved in 5 ml loading buffer [0?01 % (w/v) bromophenol blue, 0?01 % (w/v) xylene cyanol, 1 mM EDTA, in 90 % (v/v) formamide], and the solution was then separated on a denaturing 6 % polyacrylamide gel. G and A+G Maxam–Gilbert sequence ladders, used as size markers, were prepared according to Maxam & Gilbert (1977, 1980). Computational analysis. To search for paralogous and orthologous genes of ydfH, ydfI and ydfJ, SSDB (sequence similarity database; http://www.genome.ad.jp/kegg/ssdb/) in KEGG (Kyoto Encyclopedia of Genes and Genomes databases) was used. To search for genes with a YdfI putative recognition sequence in their promoter region, a web-based application, GRASP-DNA, constructed for whole-genome sequence searches was used (Schilling et al., 2000; http://www2.genomatica.com/grasp-dna/). Disk diffusion experiments. B. subtilis cells were inoculated into 200 ml LB medium at OD600 0?01 and then cultured at 37 uC for 2?5 h up to approximately OD600 1?5. Two hundred microlitres of culture was spread onto LB agar plates. A filter paper disk with antibiotics then was placed on top of the plates. The plates were incubated at 37 uC for 18 h, and the diameter of the blocking zones was measured with a digital slide gauge.
In this analysis, we used filter paper disks with thirty-one types of 1772
antibiotic. Twenty-eight types of Sensi-disc (Becton Dickinson) were used, namely the fluoroquinolone group [levofloxacin (5 mg) and sparfloxacin (5 mg)], penicillin group [carbenicillin (100 mg), piperacillin (100 mg) and ampicillin (10 mg)], monobactam group [aztreonam (30 mg)], cephem group [ceftazidime (30 mg), cefepime (30 mg) and cefoperazone (75 mg)], aminoglycoside group [spectinomycin (100 mg), kanamycin (30 mg) and streptomycin (10 mg)], macrolide group [erythromycin (15 mg), azithromycin (15 mg), clarithromycin (15 mg), roxithromycin (15 mg) and josamycin (30 mg)], lincomycin group [lincomycin (2 mg) and clindamycin (2 mg)], tetracycline group [tetracycline (30 mg) and minocycline (30 mg)], polypeptide group [vancomycin (30 mg), bacitracin (10 U), polymyxin B (300 U) and colistin (10 mg)] and others [chloramphenicol (30 mg), rifampicin (5 mg) and fosfomycin (50 mg)], as well as an SN disk (Nissui Pharmaceutical) with teicoplanin (30 mg) (polypeptide group). We also used hand-made filter paper disks (6 mm diameter) with surfactin (50 mg) and fusidic acid (100 mg). Since the YDFHIDSp strain was constructed by inserting the spectinomycin resistance gene into ydfHI loci, and the YDFJDPM4 strain harboured the erythromycin resistance gene, we could not use spectinomycin and macrolide antibiotics for YDFHIDSp and YDFJDPM4, respectively.
RESULTS Transcriptional analysis of the ydfHI genes of B. subtilis The B. subtilis genome sequence shows that ydfH and ydfI are transcribed in the same direction. In addition, rindependent terminators are located downstream of ydfI (Fig. 1). To determine the transcriptional units and expression patterns of ydfH and ydfI in the wild-type strain 168 and the ydfHI double null mutant YDFHIDSp, we performed Northern blot analysis using DIG-labelled ydfH- and
Fig. 1. Feature map of the ydfHI region. The largest arrows show the six deduced ORFs, and indicate their transcriptional and translational directions. Vertical open arrowheads indicate primer positions. The shaded bars indicate probe positions. White and black boxes indicate the regions of fragments DYDFH and DYDFI, respectively. The shaded arrow indicates the direction of insertion of a spectinomycin resistance gene to construct the ydfHI double null mutant YDFHIDSp. The small black arrow indicates the direction of Pspac insertion in YDFJDPM4. Numbers indicate the position with respect to the origin of replication, coinciding with the base numbering start point. Microbiology 151
The YdfHI system regulates ydfJ transcription
2.0 kb
16S
ydfI-specific probes. The X-ray film required an exposure time of 4?5 h, which indicates that the amounts of the transcripts were very small. Fig. 2 shows that ydfH- and ydfIspecific probes both hybridized to 2?0 and 2?1 kb mRNAs during the exponential growth phase of strain 168. The result indicated the polycistronic transcription of ydfH and ydfI. Neither transcript was detected for the ydfHI double null mutant YDFHIDSp. Incidentally, mRNA signals corresponding to the polycistronic transcription of ydfH and ydfI were not detected after t0 (the time of onset of sporulation) (data not shown). ydfJ transcription is specifically induced by YdfI overexpression It has been demonstrated that the overexpression of the response regulator in the background of deficiency of its cognate sensor kinase leads to the expression of its target genes (Kobayashi et al., 2001; Ogura et al., 2001). When the signal recognized by the sensor kinase is unknown, this feature is useful for analysing the association between a twocomponent system and its presumed target genes. In DNA microarray experiments where YdfI is overexpressed in the background of the ydfH disruptant, it has been reported that the YdfHI two-component system may regulate 27 genes including ydfJ (Kobayashi et al., 2001). Thus, we performed Northern blot analysis to confirm that ydfJ transcription is specifically induced by YdfI overexpression. ydfJ transcription was fairly weak under normal conditions (Fig. 3a). This transcription was not influenced by ydfHI disruption. To detect this transcription in Northern analysis, 20 mg RNA instead of 10 mg was loaded onto the gels. Moreover, more than 1 h was needed for exposure to the X-ray film. We transformed the ydfHI double null mutant YDFHIDSp with the multicopy plasmid pDG148ydfI. The plasmid pDG148ydfI was used for YdfI overexpression under the control of the IPTG-inducible spac promoter (Kobayashi et al., 2001). The 0?6 kb mRNA signal corresponding to ydfI http://mic.sgmjournals.org
2. 5 t_ 2
3
2.1 kb 2.0 kb
t_
3. 5
t_
t_
3
2. 5 t_ 2
t_
t_
23S
t_
2
3. 5
ydfI DIG-labelled RNA probe YDFHIDSp 168
t_
2. 5
3
2.1 kb
t_
2
t_ 3. 5 t_
t_
3
2. 5
t_
t_
t_
3. 5
ydfH DIG-labelled RNA probe 168 YDFHIDSp
23S 16S
Fig. 2. Northern blot analysis of strains ydfH and ydfI in 168 and YDFHIDSp. These strains were inoculated into 200 ml DSM at an OD600 of 0?01. Cells were harvested at various time points to allow isolation of total RNA. t”x means x hours before t0 (time of onset of sporulation). Ten micrograms of each RNA from strains 168 and YDFHIDSp was loaded onto 1 % (w/v) formaldehydeagarose gels. Signals were detected using DIG-labelled ydfH- and ydfI-specific RNA probes. The exposure time to the X-ray film (RX-U; Fujifilm) for detection was 4?5 h. Arrows indicate the positions of mRNA signals. The rRNA positions are also indicated (23S, 2?93 kb 23S rRNA; 16S, 1?55 kb 16S rRNA).
monocistronic transcription was strongly induced by the addition of IPTG (Fig. 3b, lanes 4–6). In the absence of IPTG, ydfJ transcription was not detected (Fig. 3c, lanes 1–3). However, when YdfI was overexpressed on addition of IPTG, we detected a stronger 2?2 kb mRNA signal corresponding to the ydfJ monocistronic transcript (Fig. 3c, lanes 4–6). Ten minutes exposure to the X-ray film was sufficient to detect this transcript. Judging from the above results, it is clear that ydfJ transcription is regulated by the YdfHI two-component system.
Gel shift assays with histidine-tagged YdfI protein (h-YdfI) and the ydfJ promoter region A gel shift assay was performed to examine the direct interaction between the YdfI protein and the region upstream of ydfJ. We used a histidine-tagged YdfI protein (h-YdfI) in this analysis. The h-YdfI protein (224 aa; Mr 25 212) was expressed in the presence of IPTG (inducing conditions) in E. coli M15(pREP4, pQEYDFI), and purified by nickel-affinity chromatography (data not shown). An end-labelled DNA fragment (YDFJ-Pc, 170 bp) encompassing a region from 2154 to +6 bp with respect to the 59 end of ydfJ was used as a radioactive probe. In the presence of 6?25 pmol of h-YdfI, YDFJ-Pc exhibited a mobility shift (Fig. 4, lane 2). A clearer mobility shift of YDFJ-Pc was observed with an increase in the amount of h-YdfI. In the presence of 18?75 and 25 pmol of h-YdfI, almost all the probes formed a complex with h-YdfI (Fig. 4, lanes 4 and 5). Furthermore, we performed similar gel shift assays for 12 genes (ydfE, ydgJ, ydjM, pyrR, proH, ysbA, rbsR, lctE, yqxL, ywcJ, ywbH and cydA) that had been detected as candidate genes regulated by YdfHI as a result of DNA microarray analysis (Kobayashi et al., 2001). Although the regions upstream of the 12 genes were selected as putative promoter regions and gel shift assays were performed, no gel shift was found for any of the genes (data not shown). It may be that these 12 genes are related to YdfHI indirectly. In this analysis, we focused only on genes that were indicated to have a direct interaction with the YdfI response regulator; 1773
M. Serizawa and J. Sekiguchi
(a) ydfJ DIG-labelled RNA probe 168 1
2
YDFHIDSp 3
4
5
6
(b)
(c) ydfI DIG-labelled RNA probe _ IPTG: + 1
2
3
4
5
1
6
23S
23S 2.2 kb
16S 16S
ydfJ DIG-labelled RNA probe _ +
IPTG:
2.2 kb
2
3
4
5
6
23S 16S
0.6 kb
Fig. 3. (a) Northern blot analysis of ydfJ in strains 168 and YDFHIDSp. These strains were inoculated into 200 ml LB at an OD600 of 0?01. Cells were harvested at optical densities of approximately 0?4, 0?9 and 1?8 to allow isolation of total RNA. Twenty micrograms of each RNA was loaded onto 1 % (w/v) formaldehyde-agarose gels. Signals were detected with a DIG-labelled ydfJspecific RNA probe. The exposure time to the X-ray film (RX-U; Fujifilm) for detection was 1 h. Arrows and bars indicate the positions of mRNA signals and rRNAs, respectively. (b, c) Northern blot analysis of ydfI (b) and ydfJ (c) transcripts in YDFHIDSp harbouring plasmid pDG148ydfI, used for overexpression of ydfI. After inoculation of these strains into 200 ml LB medium containing kanamycin (10 mg ml”1) at an OD600 0?01, the cells were grown at 37 6C for 1 h. IPTG was added to one of the flasks at a final concentration of 1 mM, and the cells were harvested after 1, 1?5 and 2 h. Ten micrograms of each RNA was loaded onto 1 % (w/v) formaldehyde-agarose gels. Signals were detected with DIG-labelled ydfI- (b) and ydfJ- (c) specific RNA probes. The exposure times to the X-ray film (RX-U; Fujifilm) for detection were 10 s (b) and 10 min (c).
therefore, a detailed analysis was not performed for these 12 genes. The addition of excess amounts of the non-radioactive YDFJ-Pc fragment suppressed radioactively labelled YDFJ-Pc
complex formation (Fig. 4, lanes 6–9). These results suggest that complex formation between YDFJ-Pc and h-YdfI is caused by specific interaction. Moreover, h-YdfI did not bind to an unrelated 113 bp fragment PG3-MCS, which belongs to the multi-cloning site of pGEM-3Zf(+) (Fig. 4, lanes 10–12). Therefore, it seems reasonable to conclude that the formation of the complex between h-YdfI and YDFJ-Pc is specific.
Fig. 4. Gel shift assays of h-YdfI protein and YDFJ-Pc probe DNA including the ydfJ promoter region. Radioactively labelled YDFJ-Pc (0?025 pmol) (lanes 1–5) or PG3-MCS (lanes 10–12), and 4 mg poly(dI-dC) as the competitor DNA were incubated with different amounts of h-YdfI (lanes 1 and 10, 0 pmol; lane 2, 6?25 pmol; lanes 3 and 11, 12?5 pmol; lane 4, 18?75 pmol; lanes 5 and 12, 25 pmol). PG3-MCS was used as a negative control. A competition assay was performed with constant amounts of radioactively labelled YDFJ-Pc probe (0?025 pmol) and h-YdfI (25 pmol), and different amounts of nonlabelled YDFJ-Pc probe (lane 6, 2?5 pmol; lane 7, 5 pmol; lane 8, 7?5 pmol; lane 9, 10 pmol). 1774
Microbiology 151
The YdfHI system regulates ydfJ transcription
DNase I footprinting analysis of the interaction of h-YdfI with the ydfJ promoter region and primer extension analysis of ydfJ We carried out DNase I footprinting analysis to determine the h-YdfI-binding site(s), and primer extension analysis of ydfJ (Figs 5 and 6). Fig. 6 shows that the transcriptional initiation site of ydfJ is ‘G’ and we could not detect any other significant transcripts within the region of 144 bp upstream of the 59-end of ydfJ. These results suggest the putative
promoter sequences (235 and 210) of ydfJ are TTttCA and TAcAAT, respectively (capital letters indicating the sigma A consensus sequences). h-YdfI-protected sequences in both the coding and noncoding strands of the ydfJ promoter region are located just upstream of the putative ydfJ promoter sequence (235 and 210) (Figs 5 and 6). Moreover, we found the tandem repeat sequences, GCCCaAAcGTAC and GCCCgAAtGTAC, in the h-YdfI-protected region (from 267 to 235 bp with respect to the ydfJ transcriptional initiation site). The sequence GCCCRAAYGTAC, which is the putative recognition sequence of YdfI, was called the ‘YdfI-box’. The above result suggests that the direct binding of YdfI to the ydfJ promoter region regulates ydfJ transcription. Disk diffusion analysis for detecting sensitivity to various antibiotics Since YdfJ belongs the RND superfamily, there is a possibility that YdfJ is associated with resistance to antibiotics. Thus, we investigated the sensitivity to antibiotics of strains 168 (wild-type), YDFHIDSp (ydfHI null mutant) and YDFJDPM4 (ydfJ disruptant). Filter paper disks with 31 types of antibiotic, described in Methods, were used in this analysis. However, the results obtained were contrary to our expectations: no significant difference in sensitivity to the 31 types of antibiotic between the three strains (168, YDFHIDSp and YDFJDPM4) was detected (data not shown).
DISCUSSION
Fig. 5. DNase I footprinting analysis of ydfJ promoter region. The left and right panels are DNase I footprints of the 39-end-labelled coding (YDFJ-Pc) and noncoding (YDFJ-Pn) probe DNAs. Arrowheads and vertical lines on the right side of each panel indicate the enhanced cleavage sites and protected regions, respectively. The numbers are with respect to the ydfJ transcriptional initiation site. The amount of h-YdfI protein in lanes 1–6 was 0, 62?5, 125, 187?5, 250 and 0 pmol, respectively. Lanes G and A+G indicate Maxam–Gilbert sequence ladders. http://mic.sgmjournals.org
Based on the classification of sensor kinases (in terms of the sequence around the phosphorylated histidine) and response regulators (in terms of the sequence of the output domain), YdfH and YdfI have been classified into Class II and NarL groups, respectively (Fabret et al., 1999). The YdfH sensor kinase (407 aa; Mr 46 345) has five transmembrane domains in its N-terminal region, which suggests that YdfH is a membrane-anchored protein. The C-terminal region of YdfH consists of the His PTase (histidine phosphotransferase) domain. The YdfI response regulator (213 aa; Mr 23 826) consists of the PA (phosphorylated aspartate) domain in the N-terminal region, and an output domain in the C-terminal region. A gel shift was observed with the h-YdfI protein and a DNA fragment containing the upstream region of ydfJ (YDFJ-Pc). Since the molar ratio of h-YdfI to YDFJ-Pc for stable binding was more than 750 (Fig. 4), more efficient binding may be found after phosphorylation of h-YdfI with a chemical phosphodonor such as acetylphosphate. DNase I footprinting analysis revealed the region protected by h-YdfI (Fig. 5). The protected area was from 267 to 235 bp with respect to the ydfJ transcriptional initiation site (Fig. 6). We found two tandem repeat sequences consisting of conserved 12-mer sequences (YdfI-box; GCCCRAAYGTAC). Accordingly, we presume that the tandem repeat sequence is the putative YdfJ recognition sequence. It has 1775
M. Serizawa and J. Sekiguchi
Fig. 6. Summary of the results of DNase I footprinting and primer extension analyses. The nucleotide sequences of the coding and noncoding strands of the ydfJ promoter region are given. The region exhibiting affinity to h-YdfI is boxed in black. Two horizontal arrows with numbers denote the tandem repeat sequences consisting of the two conserved 12-mer sequences (GCCCRAAYGTAC). The numbers below the sequence are with respect to the ydfJ transcriptional initiation site. Converging arrowheads indicate the putative ydfI terminator. A potential ribosome-binding site (RBS) is denoted by an open box. Vertical arrowheads and a bar indicate the enhanced cleavage sites and the 39 end of ydfI, respectively. Putative ydfJ promoter sequences (”35 and ”10) are underlined. The ”35 region (TTTTCA) and ”10 region (TACAAT), with a gap of 13 bp, are similar to those of the sA consensus sequence (TTGACA for the ”35 region and TATAAT for the ”10 region, with a gap of 17 bp) (Haldenwang, 1995). ‘+1’ indicates the transcriptional initiation site of ydfJ detected by primer extension analysis. Total RNAs (40 mg) extracted from B. subtilis YDFHIDSp harbouring pDG148ydfI (grown in the presence of IPTG for overexpression of YdfI) were used as RNA samples (they were the same RNAs as used in Fig. 3c, lane 5). Signals were detected with 32P-labelled primer YDFJ-PEX, which was designed based on the sequence from +54 to +72 with respect to the 59-end of ydfJ. Dideoxy DNA sequencing reaction mixtures with the same primer were electrophoresed in parallel (lanes C, G, T and A) as size markers.
already been reported that in five systems (PhoPR, YxdJK, CitST, DctSR and LiaRS) of B. subtilis, tandem or direct repeat sequences are located within the target sites of their response regulators (DBTBS: http://dbtbs.hgc.jp/; Joseph et al., 2004; Yamamoto et al., 2000; Asai et al., 2000; Mascher et al., 2004). To find genes other than ydfJ regulated by YdfHI, a wholegenome sequence search was performed using the webbased software GRASP-DNA. Seq-1 (GCCCAAACGTAC) or seq-2 (GCCCGAATGTAC), which are found in the putative cis-acting regulatory sequences of ydfJ, were used as query sequences in the GRASP-DNA search. Then, we studied regions in which two or more query sequences existed in tandem in the region upstream of the genes detected in the GRASP-DNA search. Two sequences similar to the YdfI-box were found to exist in tandem within the region upstream of yfkC, when seq-2 was used as a query sequence. Moreover, 1776
the sA consensus sequence was found upstream of yfkC. If YdfHI controls yfkC, the monocistronic transcription of yfkC may be specifically induced by YdfI overexpression. Therefore, we performed Northern blot analysis of yfkC under YdfI overexpression conditions in ydfHI double null mutant YDFHIDSp. However, an mRNA signal corresponding to the monocistronic transcription of yfkC was not detected. Since YdfJ belongs to the RND superfamily, there is a possibility that YdfJ is associated with resistance to antibiotics. However, we have not yet found any antibiotics that have significant effects on YDFHIDSp (ydfHI null mutant) and YDFJDPM4 (ydfJ disruptant) strains. There may be an association between YdfJ and the transport of some noxious compounds (for example, heavy-metal ions and dyes) other than antibiotics. Moreover, it may be necessary to investigate the association between YdfJ and the transport Microbiology 151
The YdfHI system regulates ydfJ transcription
and biosynthesis of lipids. YdfJ belongs to the HAE2 family, which is a subfamily of the RND superfamily (Tseng et al., 1999). The HAE2 family is specific to Gram-positive bacteria and is involved in not only drug resistance but also the transport and biosynthesis of lipids (transport classification database; http://tcdb.ucsd.edu/tcdb/). For example, mmpL7 and mmpL8 of Mycobacterium tuberculosis are required for the efficient translocation of phthiocerol dimycocerosate (Camacho et al., 2001) and for sulfolipid-1 biosynthesis (Converse et al., 2003), respectively. CAC3431 of Clostridium acetobutylicum ATCC 824 shows a high amino acid sequence similarity with ydfJ (Smith– Waterman similarity score, 2026; identity 45?4 %). CAC3431, as well as ydfJ, belongs to the HAE2 family, and is predicted to function as a multidrug-efflux pump (transportDB; http://www.membranetransport.org/). Moreover, CAC3429 and CAC3430, which are located adjacent to CAC3431, have high amino acid sequence similarities to YdfI (response regulator) and YdfH (sensor kinase), respectively. Consequently, it is quite likely that CAC3431 is regulated by a two-component system consisting of CAC3429 and CAC3430 in C. acetobutylicum ATCC 824. The gene organization of C. acetobutylicum was similar to that of ydfH–ydfI (two-component system) and ydfJ (RND superfamily member), and it was the only case in the sequence similarity database (SSDB: 160 bacteria are currently registered). In this study, we have demonstrated that ydfJ of the RND superfamily is regulated by the YdfHI two-component system. YdfI (the response regulator) directly binds to the ydfJ promoter region, and tandem repeat sequences are present in the YdfI-binding site. However, we could not identify the signal recognized by the YdfH sensor kinase. Most RND superfamily members have a role in resistance to a wide range of noxious compounds. As a future study, it will be necessary to investigate the association between YdfJ and the transport of lipids, heavy-metal ions and dyes.
ACKNOWLEDGEMENTS We are grateful to M. Watanabe for the construction of pQEYDFI. We also thank H. Yamamoto and S. Tojo (Fukuyama University) for kind technical advice, and A. Chaki and K. Kodama for experimental assistance. For radioisotope and DNA sequence analyses, some equipment in the Gene Research Center of Shinshu University was used. This work was supported by a Grant-in-aid for Scientific Research on Priority Areas, Genome Biology (12206005) (to J. S.), Grant-in-aid for JSPS Fellows (15061544) (to M. S.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and JSPS Research Fellowships for Young Scientists (to M. S.) from the Japan Society for the Promotion of Science.
REFERENCES Aguilar, P. S., Hernandez-Arriaga, A. M., Cybulski, L. E., Erazo, A. C. & de Mendoza, D. (2001). Molecular basis of thermosensing: a two-
component signal transduction thermometer in Bacillus subtilis. EMBO J 20, 1681–1691. http://mic.sgmjournals.org
Asai, K., Baik, S. H., Kasahara, Y., Moriya, S. & Ogasawara, N. (2000). Regulation of the transport system for C4-dicarboxylic acids
in Bacillus subtilis. Microbiology 146, 263–271. Camacho, L. R., Constant, P., Raynaud, C., Laneelle, M. A., Triccas, J. A., Gicquel, B., Daffe, M. & Guilhot, C. (2001). Analysis of the
phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. Evidence that this lipid is involved in the cell wall permeability barrier. J Biol Chem 276, 19845–19854. Converse, S. E., Mougous, J. D., Leavell, M. D., Leary, J. A., Bertozzi, C. R. & Cox, J. S. (2003). MmpL8 is required for sulfolipid-1
biosynthesis and Mycobacterium tuberculosis virulence. Proc Natl Acad Sci U S A 100, 6121–6126. Doan, T., Servant, P., Tojo, S., Yamaguchi, H., Lerondel, G., Yoshida, K., Fujita, Y. & Aymerich, S. (2003). The Bacillus subtilis
ywkA gene encodes a malic enzyme and its transcription is activated by the YufL/YufM two component system in response to malate. Microbiology 149, 2331–2343. Fabret, C., Feher, V. A. & Hoch, J. A. (1999). Two-component signal
transduction in Bacillus subtilis: how one organism sees its world. J Bacteriol 181, 1975–1983. Fukuchi, K., Kasahara, Y., Asai, K., Kobayashi, K., Moriya, S. & Ogasawara, N. (2000). The essential two-component regulatory
system encoded by yycF and yycG modulates expression of the ftsAZ operon in Bacillus subtilis. Microbiology 146, 1573–1583. Grkovic, S., Brown, M. H. & Skurray, R. A. (2002). Regulation of
bacterial drug export systems. Microbiol Mol Biol Rev 66, 671–701. Haldenwang, W. G. (1995). The sigma factors of Bacillus subtilis.
Microbiol Rev 59, 1–30. Hulett, F. M. (1996). The signal-transduction network for Pho
regulation in Bacillus subtilis. Mol Microbiol 19, 933–939. Hyyrylainen, H. L., Bolhuis, A., Darmon, E. & 8 other authors (2001).
A novel two-component regulatory system in Bacillus subtilis for the survival of severe secretion stress. Mol Microbiol 41, 1159–1172. Ishikawa, S., Hara, Y., Ohnishi, R. & Sekiguchi, J. (1998). Regulation
of a new cell wall hydrolase gene, cwlF, which affects cell separation in Bacillus subtilis. J Bacteriol 180, 2549–2555. Joseph, P., Guiseppi, A., Sorokin, A. & Denizot, F. (2004). Charac-
terization of the Bacillus subtilis YxdJ response regulator as the inducer of expression for the cognate ABC transporter YxdLM. Microbiology 150, 2609–2617. Kobayashi, K., Ogura, M., Yamaguchi, H., Yoshida, K., Ogasawara, N., Tanaka, T. & Fujita, Y. (2001). Comprehensive DNA microarray
analysis of Bacillus subtilis two-component regulatory systems. J Bacteriol 183, 7365–7370. Mascher, T., Zimmer, S. L., Smith, T. A. & Helmann, J. D. (2004).
Antibiotic-inducible promoter regulated by the cell envelope stresssensing two-component system LiaRS of Bacillus subtilis. Antimicrob Agents Chemother 48, 2888–2896. Maxam, A. M. & Gilbert, W. (1977). A new method for sequencing
DNA. Proc Natl Acad Sci U S A 74, 560–564. Maxam, A. M. & Gilbert, W. (1980). Sequencing end-labeled DNA
with base-specific chemical cleavages. Methods Enzymol 65, 499–560. Msadek, T., Kunst, F. & Rapoport, G. (1995). A signal transduction
network in Bacillus subtilis includes the DegS/DegU and ComP/ ComA two-component systems. In Two-Component Signal Transduction, pp. 447–471. Edited by J. A. Hoch & T. J. Silhavy. Washington, DC: American Society for Microbiology. Ogura, M., Yamaguchi, H., Yoshida, K., Fujita, Y. & Tanaka, T. (2001). DNA microarray analysis of Bacillus subtilis DegU, ComA
and PhoP regulons: an approach to comprehensive analysis of B. subtilis two-component regulatory systems. Nucleic Acids Res 29, 3804–3813. 1777
M. Serizawa and J. Sekiguchi
Ohki, R., Giyanto, Tateno, K., Masuyama, W., Moriya, S., Kobayashi, K. & Ogasawara, N. (2003). The BceRS two-component regulatory
of aerobic and anaerobic respiration in Bacillus subtilis. J Bacteriol 178, 1374–1385.
system induces expression of the bacitracin transporter, BceAB, in Bacillus subtilis. Mol Microbiol 49, 1135–1144.
Tanaka, K., Kobayashi, K. & Ogasawara, N. (2003). The Bacillus subtilis
Schaeffer, P., Millet, J. & Aubert, J. P. (1965). Catabolic repression of
bacterial sporulation. Proc Natl Acad Sci U S A 54, 704–711. Schilling, C. H., Held, L., Torre, M. & Saier, M. H., Jr (2000). GRASP-
DNA: a web application to screen prokaryotic genomes for specific DNA-binding sites and repeat motifs. J Mol Microbiol Biotechnol 2, 495–500. Serizawa, M., Yamamoto, H., Yamaguchi, H., Fujita, Y., Kobayashi, K., Ogasawara, N. & Sekiguchi, J. (2004). Systematic analysis of
SigD-regulated genes in Bacillus subtilis by DNA microarray and Northern blotting analyses. Gene 329, 125–136.
YufLM two-component system regulates the expression of the malate transporters MeaN (YufR) and YflS, and is essential for utilization of malate in minimal medium. Microbiology 149, 2317–2329. Tekaia, F., Gordon, S. V., Garnier, T., Brosch, R., Barrell, B. G. & Cole, S. T. (1999). Analysis of the proteome of Mycobacterium
tuberculosis in silico. Tuber Lung Dis 79, 329–342. Tseng, T. T., Gratwick, K. S., Kollman, J., Park, D., Nies, D. H., Goffeau, A. & Saier, M. H., Jr (1999). The RND permease superfamily: an ancient,
ubiquitous and diverse family that includes human disease and development proteins. J Mol Microbiol Biotechnol 1, 107–125. Vagner, V., Dervyn, E. & Ehrlich, S. D. (1998). A vector for systematic
Stock, J. B., Surette, M. G., Levit, M. & Park, P. (1995). Two-
gene inactivation in Bacillus subtilis. Microbiology 144, 3097–3104.
component signal transduction systems: structure-function relationships and mechanisms of catalysis. In Two-Component Signal Transduction, pp. 25–52. Edited by J. A. Hoch & T. J. Silhavy. Washington, DC: American Society for Microbiology.
Yamamoto, H., Murata, M. & Sekiguchi, J. (2000). The CitST two-
Sun, G., Sharkova, E., Chesnut, R., Birkey, S., Duggan, M. F., Sorokin, A., Pujic, P., Ehrlich, S. D. & Hulett, F. M. (1996). Regulators
Organization and transcription of the myo-inositol operon, iol, of Bacillus subtilis. J Bacteriol 179, 4591–4598.
1778
component system regulates the expression of the Mg-citrate transporter in Bacillus subtilis. Mol Microbiol 37, 898–912. Yoshida, K., Aoyama, D., Ishio, I., Shibayama, T. & Fujita, Y. (1997).
Microbiology 151
DOI 10.1099/mic.0.27619-0
The Bacillus subtilis YdfHI two-component system regulates the transcription of ydfJ, a member of the RND superfamily Masakuni Serizawa and Junichi Sekiguchi Department of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, 3-15-1 Tokida, Ueda-shi, Nagano 386-8567, Japan
Correspondence Junichi Sekiguchi [email protected]
Received 13 September 2004 Revised
1 February 2005
Accepted 22 February 2005
The ydfHI genes encode a sensor kinase and a response regulator forming a two-component system. ydfJ is located downstream of ydfHI, and belongs to the RND (resistance-nodulation-cell division) superfamily, which is present in most major organisms. Four genes (secDF, yerP, ydfJ and ydgH) in Bacillus subtilis belong to this family. This study revealed that the YdfHI two-component system regulates ydfJ transcription. A gel shift assay using histidine-tagged YdfI (h-YdfI) showed that it directly binds to the ydfJ promoter region. Moreover, DNase I footprinting analysis revealed a tandem repeat sequence consisting of two conserved 12-mer sequences (GCCCRAAYGTAC) within the h-YdfI-binding site.
INTRODUCTION In micro-organisms, a two-component system is a very important signal transduction system for adaptation to drastic and immediate changes in external or internal environmental conditions. This system is usually composed of a sensor kinase and a response regulator. The sensor kinase monitors some type of signal caused by changes in environmental conditions, and transmits the information to the response regulator via a phosphoryl-transfer reaction. The response regulator is shifted to its active state by the phosphate group received from the sensor kinase, and directly binds to the promoter region of its target genes as a transcriptional regulator (Stock et al., 1995). Twenty-nine adjacent sets of genes encoding the sensor kinase and response regulator are recognized in Bacillus subtilis. The functions of thirteen systems, namely CitST (Yamamoto et al., 2000), ComPA (Msadek et al., 1995), CssSR (Hyyrylainen et al., 2001), DctSR (Asai et al., 2000), DegSU (Msadek et al., 1995), DesKR (Aguilar et al., 2001), PhoRP (Hulett, 1996), ResED (Sun et al., 1996), BceRS (Ohki et al., 2003), YufLM (Doan et al., 2003; Tanaka et al., 2003), LiaRS (Mascher et al., 2004), YxdJK (Joseph et al., 2004) and YycFG (Fukuchi et al., 2000), have been reported. It has been recognized that those systems are necessary for micro-organisms to survive under various conditions. Sixteen other systems may also have certain important functions. Genes regulated by a two-component system tend to be located adjacent to the genes encoding the two-component system. Moreover, there is a close association between the signal that a sensor kinase recognizes and the function of Abbreviation: RND, resistance-nodulation-cell division.
0002-7619 G 2005 SGM
Printed in Great Britain
the regulated genes. For example, BceRS regulates bceAB transcription, and bceAB is located downstream of bceRS. bceAB encodes the subunits of the ABC transporter that expels bacitracin from inside the cell. The transcription of bceAB is induced by BceRS, which is activated by the addition of extracellular bacitracin (Ohki et al., 2003). The same phenomenon is also observed in CitST, CssSR, DctSR and DesKR. We studied the genes that are located adjacent to the 16 unknown two-component systems. Genes associated with substance transport were recognized adjacent to 9 two-component systems (YcbAB, YcbML, YccGH, YclKJ, YdfHI, YesMN, YfiJK, YvcPQ and YvfTU). ABC transporter homologues were recognized adjacent to 6 two-component systems (YcbML, YccGH, YclKJ, YfiJK, YvcPQ and YvfTU). ydfJ is located downstream of ydfHI. YdfJ (724 aa; Mr 76 850) has 12 transmembrane segments, two MMPL (Tekaia et al., 1999) domains and an SS (sterol sensing) domain, and belongs to the RND (resistance-nodulationcell division) superfamily that is present in most major organisms. Most genes assigned to this superfamily encode proteins that catalyse substrate efflux via a H+ antiport mechanism. Members of this family are associated with multidrug resistance, heavy-metal ion export, transport of oligosaccharides, and solvent tolerance (Tseng et al., 1999). However, little is known about noxious compound resistance systems mediated by genes involved in this family in low-G+C Gram-positive bacteria. Therefore, the analysis of genes in the RND superfamily of B. subtilis as a model bacterium is important. In DNA microarray experiments under the overexpression of a response regulator (YdfI), ydfJ is regulated by a YdfHI two-component system (Kobayashi et al., 2001). Moreover, there are some reports of an association between 1769
M. Serizawa and J. Sekiguchi
two-component systems and drug efflux genes (Grkovic et al., 2002). Thus, we were interested in determining the association between the YdfHI two-component system and ydfJ transcription, and also the roles of YdfHI and YdfJ in antibiotic resistance and substance transport. In this analysis, we report the positive regulation of ydfJ transcription mediated by the YdfHI two-component system.
METHODS Bacterial strains, plasmids, primers and culture conditions.
The bacterial strains and plasmids used in this study are listed in Table 1. The primers used are listed in Table 2. The bacterial strains were cultured in LB medium (g l21: yeast extract, 5; polypeptone, 10; NaCl, 5; pH 7?2) at 37 uC. When necessary, ampicillin, spectinomycin or kanamycin was added at final concentrations of 50, 50 and 10 mg ml21, respectively. B. subtilis strains were also grown in Difco sporulation medium (DSM) (Schaeffer et al., 1965). Construction of the spectinomycin-resistance-gene harbouring plasmid. A BamHI–XhoI fragment from plasmid pDG1727
including the spectinomycin resistance gene was ligated into the corresponding sites of pBluescriptII-SK(+) to construct pBlueSPR. Construction of the ydfH ydfI double null mutant. A ydfH ydfI double null mutant was constructed by the PCR ligation method. Fragments DYDFH and DYDFI contained the 59-end sequence of ydfH and the 39-end sequence of ydfI, respectively. These fragments were amplified from B. subtilis 168 chromosomal DNA, and the primers YDFH-BF1 and YDFH-R1, and YDFI-F2 and YDFI-XR2, respectively. Fragment SPR was amplified from plasmid pBlueSPR, containing the spectinomycin resistance gene, and the primers
PB-M13Rev and PB-M13-20. The 59-end sequences of YDFH-R1 and YDFI-F2 are complementary to PB-M13-20 and PB-M13Rev, respectively. Fragment YDFHI-SPR was amplified from a mixture of fragments DYDFH, DYDFI and SPR, and the primers YDFH-BF1 and YDFI-XR2. Fragment YDFHI-SPR was used for the transformation of B. subtilis 168, and the ydfHI null mutant YDFHIDSp was selected on an agar plate containing spectinomycin. Construction of the ydfJ disruptant. A ydfJ internal fragment amplified from 168 chromosomal DNA and the primers YDFJ-FE and YDFJ-RB was digested with EcoRI and BamHI. Then the digested fragment was ligated into the EcoRI and BamHI sites of pMUTIN4, and Escherichia coli JM109 was transformed with the ligation mixture to produce pM4YDFJ. Subsequently, YDFJDPM4 was constructed by Campbell-type integration of the plasmid DNA prepared from E. coli C600 cells harbouring pM4YDFJ. The proper integration of the plasmid was confirmed by PCR. Construction of a plasmid for producing 6¾His-tag-fused YdfI in E. coli. For the overproduction and purification of the
66His-tag-fused response regulator YdfI in E. coli, the expression plasmid pQEYDFI was constructed. A 680 bp PCR fragment obtained with the primers YDFI-HisFB and YDFI-HisRP was digested with BamHI and PstI, followed by ligation into the corresponding sites of plasmid pGEM-3Zf(+). E. coli JM109 cells were transformed with the ligation mixture to produce pGYDFI. The nucleotide sequence was confirmed with a DNA sequencer (ABI Prism 310 Genetic Analyser; Applied Biosytems). A BamHI–PstI fragment of pGYDFI including ydfI was ligated in the corresponding sites of the histidine-tagged plasmid pQE-30. The resultant plasmid pQEYDFI was used for the transformation of E. coli M15 harbouring the plasmid pREP4. Consequently, the synthesis of the histidine-tagged YdfI (h-YdfI) was controlled by IPTG induction.
Table 1. Bacterial strains and plasmids Strain or plasmid B. subtilis 168 YDFHIDSp YDFJDPM4 E. coli JM109 C600 M15 Plasmid pGEM-3Zf(+) pBluescriptII-SK(+) pDG1727 pREP4 pQE30 pMUTIN4 pBlueSPR pGYDFI pQEYDFI pDG148ydfI pM4YDFJ
Relevant genotype
Source or reference*
trpC2 trpC2 ydfHI : : spc trpC2 ydfJ : : pM4YDFJ
S. D. Ehrlich This study This study
recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi-1 D(lac–proAB) /F9(traD36 proAB+ lacIq lacZDM15) supE44 hsdR17 thi-1 thr-1 leuB6 lacY1 tonA21 Nals Strs Rifs lac ara gal mtl F2 recA+ uvr+
Takara Bio Laboratory stock Qiagen
bla lacZ bla lacZ bla spc lacI neo bla erm bla lacZ lacI Pspac bla spc bla ydfI bla ydfI bla kan ydfI pMUTIN4 : : DydfJ
Promega Stratagene BGSC Qiagen Qiagen Vagner et al. (1998) This study This study This study Kobayashi et al. (2001) This study
*BGSC, Bacillus Genetic Stock Center, Ohio State University, Columbus, USA; S. D. Ehrlich, INRA, Jouy-en-Josas, France. 1770
Microbiology 151
The YdfHI system regulates ydfJ transcription
Table 2. Primers Primer YDFH-BF1 YDFH-R1 YDFI-F2 YDFI-XR2 PB-M13-20 PB-M13Rev YDFH-FE YDFH-RB YDFI-FE YDFI-RB YDFJ-FE YDFJ-RB YFKC-FE YFKC-RB YDFJP-F YDFJP-R YDFI-HisFB YDFI-HisRP YDFJ-PEX PET-T7
Sequence (5§R3§)* gcgcGGATCCTTACTCACATGATAGGCGG CACTGGCCGTCGTTTTACATACGCCGAATTTATGACCA CATGGTCATAGCTGTTTCCGGATATCTGTTAAAAGATACG gccgCTCGAGTTGTCTATTGTCAGAATACCT GTAAAACGACGGCCAGTG GGAAACAGCTATGACCATG gcgcGAATTCTTACTCACATGATAGGCGG GTAATACGACTCACTATAGGGCGGATCCTCTGTCTGCCATTCCTATAA gcgcGAATTCCGTTGATGACCATCTTGTC GTAATACGACTCACTATAGGGCGGATCCTCTGATGGCTGCATCCATT gcgcGAATTCATGGGTTGCTCGCAATCG GTAATACGACTCACTATAGGGCGGATCCGACTTGCAATCGAGTCAAC gcgcGAATTCTCGTCGATATTCTCCTCGT GTAATACGACTCACTATAGGGCGGATCCTATCTTGCCGAAATCATGCA gcgcgcCTGCAGGAATTCATTGCCATGCAAAAAGGTATT gcgccgCAATTGGTCGACTGACATGATAATCTCCTTTCA gccgGGATCCAATAAGGTTTTAATCGTTGATG gcgcCTGCAGGGCAATTTTCAAATATGCAGT GATCCACGCACATATTGCT TAATACGACTCACTATAGGG
Restriction enzyme BamHI
XhoI
EcoRI BamHI EcoRI BamHI EcoRI BamHI EcoRI BamHI PstI, EcoRI MunI, SalI BamHI PstI
*The additional sequences (lower case), restriction sites (underlined) and T7 RNA polymerase recognition sequences (bold italics) are indicated. Transformation of E. coli and B. subtilis. This was performed
as described previously (Ishikawa et al., 1998). Northern blot analysis. Total RNA preparation and purification were performed as described by Serizawa et al. (2004). The Northern blot analysis of RNAs fractionated by electrophoresis in agarose– formaldehyde gels was performed as described by Ishikawa et al. (1998). The transfer of RNAs onto nylon membranes was performed with a vacuum blotter (model BS-31; Bio Craft). Probe labelling was performed with a DIG RNA labelling kit (Roche Diagnostics) according to the manufacturer’s instructions, but with some minor modifications. Templates for the ydfH-, ydfI-, ydfJ- and yfkC-specific probes were constructed by PCR. ydfH-, ydf-I, ydfJ- and yfkCinternal fragments were amplified from B. subtilis 168 chromosomal DNA, and the primers YDFH-FE and YDFH-RB, YDFI-FE and YDFI-RB, YDFJ-FE and YDFJ-RB, and YFKC-FE and YFKC-RB, respectively. The 59-end sequences of YDFH-RB, YDFI-RB, YDFJRB and YFKC-RB contain the sequence of the T7 RNA polymerase recognition site. The amplified fragments were digested with EcoRI, and then used as templates for in vitro run-off transcription with T7 RNA polymerase. Hybridization and detection were performed with a DIG luminescent detection kit (Roche Diagnostics), according to the manufacturer’s instructions. Primer extension analysis. This was performed as described previously (Yoshida et al., 1997). Total RNA (40 mg) was hybridized
with a primer YDFJ-PEX that had been labelled at the 59-end using T4 polynucleotide kinase (Megalabel kit, Takara Bio) and [c-32P]ATP (Amersham Biosciences). Unincorporated [c-32P]ATP was removed using a MicroSpin S200HR column (Amersham Biosciences). Primer extension reactions were performed with Molony murine leukaemia virus reverse transcriptase (Reverse transcriptase M-MLV; Takara Bio). Dideoxy sequence ladders for use as size markers were prepared with the Takara taq cycle sequencing kit (Takara Bio). Overexpression and purification of h-YdfI. E. coli M15
harbouring pREP4 and pQEYDFJ was cultured in 500 ml LB medium http://mic.sgmjournals.org
containing ampicillin (50 mg ml21), kanamycin (20 mg ml21) and glucose (1 %, w/v) until the cell density reached approximately OD600 0?6 at 37 uC. Then, IPTG was added to the culture at a final concentration of 1 mM, followed by further incubation for 1?5 h. The culture was centrifuged and the pellet was resuspended in 10 ml 10 mM imidazole-NPB solution [10 mM imidazole and 1 M NaCl in 20 mM sodium phosphate buffer (pH 7?4)]. After ultrasonication, the suspension was centrifuged, and the supernatant was filtered through a 0?45 mm membrane filter (DISMIC-13CP cellulose acetate 0?45 mm; Advantec), and applied onto a HiTrap chelating column (1 ml; Amersham Biosciences). The column was washed with 20 ml 10 mM imidazole-NPB solution, and the h-YdfI protein was then eluted with NPB solution containing a stepwise gradient of imidazole, from 20 to 500 mM. The calculated molecular mass of h-YdfI was 25 212 Da. The purified h-YdfI protein was dialysed in PD buffer [40 mM Tris/HCl (pH 7?2) containing 6 mM MgCl2, 1 mM DTT, 50 mM KCl, 0?5 mM CaCl2, 10 % (v/v) glycerol, 200 mM NaCl, 20 mM imidazole] using a dialysis membrane (size 18; Wako). Preparation of radioactively labelled DNA probes for gel shift assay and DNase I footprinting analysis. The probes
YDFJ-Pc and YDFJ-Pn are 39-end radioactively labelled probes of the coding and noncoding strands of the ydfJ upstream region, respectively. The probe PG3-MCS was used as a negative control in the gel shift assay. To construct YDFJ-Pc and YDFJ-Pn, a 196 bp DNA fragment containing the ydfJ promoter region was amplified from B. subtilis 168 chromosomal DNA, and the primers YDFJP-F and YDFJP-R. For the construction of PG3-MCS, a 135 bp fragment was amplified from pGEM-3Zf(+), and the primers PET-T7 and PB-M13Rev. These fragments were purified with a QIAquick gel extraction kit (Qiagen). YDFJ-Pc, YDFJ-Pn and PG3-MCS were digested with EcoRI and SalI, PstI and MunI and EcoRI, respectively. Accordingly, 170, 182 and 113 bp fragments were obtained. Five picomoles each of YDFJ-Pc, YDFJ-Pn and PG3-MCS DNAs were labelled by incubation at 10 uC for 1 h with 1?85 MBq [a-32P]dATP 1771
M. Serizawa and J. Sekiguchi (Amersham Biosciences) and 3 U of the Klenow fragment of DNA polymerase I (Takara Bio). Unincorporated nucleotides were removed using a MicroSpin S400HR column (Amersham Biosciences). The fragments were then ethanol precipitated, and the pellet was dissolved in 100 ml sterilized ultrapure water. The YDFJ-Pc, YDFJ-Pn and PG3MCS DNAs were digested with SalI, PstI and EcoRI, respectively. After incubation at 37 uC for 6 h, the restriction enzymes were completely removed with Micropure-EZ (Millipore) and the DNA was ethanol precipitated. The pellets were dissolved in 200 ml sterilized ultrapure water at a final concentration of 0?025 pmol ml21. Gel shift assay. Radioactively labelled YDFJ-Pc and PG3-MCS
DNAs were used. Binding reactions were performed with a fixed amount of probe DNA (0?025 pmol), 4 mg of poly(dI-dC) (Amersham Biosciences) and different amounts of h-YdfI (0, 6?25, 12?5, 18?75 and 25 pmol) at 20 uC for 1 h in GB buffer [40 mM Tris/HCl (pH 7?2) containing 6 mM MgCl2, 1 mM DTT, 50 mM KCl, 0?5 mM CaCl2, 10 % (v/v) glycerol, 200 mM NaCl, 20 mM imidazole, 1 % (v/v) Tween 20] in 20 ml total volume. Two microlitres of loading dye [0?2 % (w/v) bromophenol blue, 0?1 % (w/v) xylene cyanol, 40 % (v/v) glycerol, 60 % (v/v) TBE buffer diluted to one fourth (TBE buffer: 50 mM Tris, 48?5 mM boric acid, 2 mM EDTA)] was added to each reaction mixture, and the samples were loaded onto an 8 % native polyacrylamide gel [the ratio of acrylamide to bisacrylamide was 75 to 1 (w/w)]. The competition assay was performed with a fixed amount of radioactively labelled YDFJPc (0?025 pmol), different amounts of non-labelled YDFJ-Pc (2?5, 5, 7?5 and 10 pmol), 4 mg poly(dI-dC), and a fixed amount of h-YdfI (25 pmol) at 20 uC for 1 h in GB buffer in a total volume of 20 ml. DNase I footprinting analysis. Radioactively labelled YDFJ-Pc
(coding strand) and YDFJ-Pn (noncoding strand) were used in this analysis. Binding reactions were performed with a fixed amount of radioactive probe (0?125 pmol), 20 mg poly(dI-dC) and different amounts of h-YdfI (0, 62?5, 125, 187?5 and 250 pmol) at 20 uC for 1 h in GB buffer in 100 ml total volume. Subsequently, 1 ml DNase I solution (3 units ml21; Takara Bio) was added to each reaction mixture, followed by incubation for 1 min at 20 uC. DNase I digestion was terminated by the addition of 100 ml ice-cold DNase I stop solution [1?5 M sodium acetate (pH 5?2) containing 0?02 M EDTA, 0?02 mg ml21 sonicated salmon sperm DNA (Stratagene)], and then the mixture was subjected to phenol/chloroform/isoamyl alcohol (25 : 24 : 1, by vol.) extraction and ethanol precipitation. The pellet was dissolved in 5 ml loading buffer [0?01 % (w/v) bromophenol blue, 0?01 % (w/v) xylene cyanol, 1 mM EDTA, in 90 % (v/v) formamide], and the solution was then separated on a denaturing 6 % polyacrylamide gel. G and A+G Maxam–Gilbert sequence ladders, used as size markers, were prepared according to Maxam & Gilbert (1977, 1980). Computational analysis. To search for paralogous and orthologous genes of ydfH, ydfI and ydfJ, SSDB (sequence similarity database; http://www.genome.ad.jp/kegg/ssdb/) in KEGG (Kyoto Encyclopedia of Genes and Genomes databases) was used. To search for genes with a YdfI putative recognition sequence in their promoter region, a web-based application, GRASP-DNA, constructed for whole-genome sequence searches was used (Schilling et al., 2000; http://www2.genomatica.com/grasp-dna/). Disk diffusion experiments. B. subtilis cells were inoculated into 200 ml LB medium at OD600 0?01 and then cultured at 37 uC for 2?5 h up to approximately OD600 1?5. Two hundred microlitres of culture was spread onto LB agar plates. A filter paper disk with antibiotics then was placed on top of the plates. The plates were incubated at 37 uC for 18 h, and the diameter of the blocking zones was measured with a digital slide gauge.
In this analysis, we used filter paper disks with thirty-one types of 1772
antibiotic. Twenty-eight types of Sensi-disc (Becton Dickinson) were used, namely the fluoroquinolone group [levofloxacin (5 mg) and sparfloxacin (5 mg)], penicillin group [carbenicillin (100 mg), piperacillin (100 mg) and ampicillin (10 mg)], monobactam group [aztreonam (30 mg)], cephem group [ceftazidime (30 mg), cefepime (30 mg) and cefoperazone (75 mg)], aminoglycoside group [spectinomycin (100 mg), kanamycin (30 mg) and streptomycin (10 mg)], macrolide group [erythromycin (15 mg), azithromycin (15 mg), clarithromycin (15 mg), roxithromycin (15 mg) and josamycin (30 mg)], lincomycin group [lincomycin (2 mg) and clindamycin (2 mg)], tetracycline group [tetracycline (30 mg) and minocycline (30 mg)], polypeptide group [vancomycin (30 mg), bacitracin (10 U), polymyxin B (300 U) and colistin (10 mg)] and others [chloramphenicol (30 mg), rifampicin (5 mg) and fosfomycin (50 mg)], as well as an SN disk (Nissui Pharmaceutical) with teicoplanin (30 mg) (polypeptide group). We also used hand-made filter paper disks (6 mm diameter) with surfactin (50 mg) and fusidic acid (100 mg). Since the YDFHIDSp strain was constructed by inserting the spectinomycin resistance gene into ydfHI loci, and the YDFJDPM4 strain harboured the erythromycin resistance gene, we could not use spectinomycin and macrolide antibiotics for YDFHIDSp and YDFJDPM4, respectively.
RESULTS Transcriptional analysis of the ydfHI genes of B. subtilis The B. subtilis genome sequence shows that ydfH and ydfI are transcribed in the same direction. In addition, rindependent terminators are located downstream of ydfI (Fig. 1). To determine the transcriptional units and expression patterns of ydfH and ydfI in the wild-type strain 168 and the ydfHI double null mutant YDFHIDSp, we performed Northern blot analysis using DIG-labelled ydfH- and
Fig. 1. Feature map of the ydfHI region. The largest arrows show the six deduced ORFs, and indicate their transcriptional and translational directions. Vertical open arrowheads indicate primer positions. The shaded bars indicate probe positions. White and black boxes indicate the regions of fragments DYDFH and DYDFI, respectively. The shaded arrow indicates the direction of insertion of a spectinomycin resistance gene to construct the ydfHI double null mutant YDFHIDSp. The small black arrow indicates the direction of Pspac insertion in YDFJDPM4. Numbers indicate the position with respect to the origin of replication, coinciding with the base numbering start point. Microbiology 151
The YdfHI system regulates ydfJ transcription
2.0 kb
16S
ydfI-specific probes. The X-ray film required an exposure time of 4?5 h, which indicates that the amounts of the transcripts were very small. Fig. 2 shows that ydfH- and ydfIspecific probes both hybridized to 2?0 and 2?1 kb mRNAs during the exponential growth phase of strain 168. The result indicated the polycistronic transcription of ydfH and ydfI. Neither transcript was detected for the ydfHI double null mutant YDFHIDSp. Incidentally, mRNA signals corresponding to the polycistronic transcription of ydfH and ydfI were not detected after t0 (the time of onset of sporulation) (data not shown). ydfJ transcription is specifically induced by YdfI overexpression It has been demonstrated that the overexpression of the response regulator in the background of deficiency of its cognate sensor kinase leads to the expression of its target genes (Kobayashi et al., 2001; Ogura et al., 2001). When the signal recognized by the sensor kinase is unknown, this feature is useful for analysing the association between a twocomponent system and its presumed target genes. In DNA microarray experiments where YdfI is overexpressed in the background of the ydfH disruptant, it has been reported that the YdfHI two-component system may regulate 27 genes including ydfJ (Kobayashi et al., 2001). Thus, we performed Northern blot analysis to confirm that ydfJ transcription is specifically induced by YdfI overexpression. ydfJ transcription was fairly weak under normal conditions (Fig. 3a). This transcription was not influenced by ydfHI disruption. To detect this transcription in Northern analysis, 20 mg RNA instead of 10 mg was loaded onto the gels. Moreover, more than 1 h was needed for exposure to the X-ray film. We transformed the ydfHI double null mutant YDFHIDSp with the multicopy plasmid pDG148ydfI. The plasmid pDG148ydfI was used for YdfI overexpression under the control of the IPTG-inducible spac promoter (Kobayashi et al., 2001). The 0?6 kb mRNA signal corresponding to ydfI http://mic.sgmjournals.org
2. 5 t_ 2
3
2.1 kb 2.0 kb
t_
3. 5
t_
t_
3
2. 5 t_ 2
t_
t_
23S
t_
2
3. 5
ydfI DIG-labelled RNA probe YDFHIDSp 168
t_
2. 5
3
2.1 kb
t_
2
t_ 3. 5 t_
t_
3
2. 5
t_
t_
t_
3. 5
ydfH DIG-labelled RNA probe 168 YDFHIDSp
23S 16S
Fig. 2. Northern blot analysis of strains ydfH and ydfI in 168 and YDFHIDSp. These strains were inoculated into 200 ml DSM at an OD600 of 0?01. Cells were harvested at various time points to allow isolation of total RNA. t”x means x hours before t0 (time of onset of sporulation). Ten micrograms of each RNA from strains 168 and YDFHIDSp was loaded onto 1 % (w/v) formaldehydeagarose gels. Signals were detected using DIG-labelled ydfH- and ydfI-specific RNA probes. The exposure time to the X-ray film (RX-U; Fujifilm) for detection was 4?5 h. Arrows indicate the positions of mRNA signals. The rRNA positions are also indicated (23S, 2?93 kb 23S rRNA; 16S, 1?55 kb 16S rRNA).
monocistronic transcription was strongly induced by the addition of IPTG (Fig. 3b, lanes 4–6). In the absence of IPTG, ydfJ transcription was not detected (Fig. 3c, lanes 1–3). However, when YdfI was overexpressed on addition of IPTG, we detected a stronger 2?2 kb mRNA signal corresponding to the ydfJ monocistronic transcript (Fig. 3c, lanes 4–6). Ten minutes exposure to the X-ray film was sufficient to detect this transcript. Judging from the above results, it is clear that ydfJ transcription is regulated by the YdfHI two-component system.
Gel shift assays with histidine-tagged YdfI protein (h-YdfI) and the ydfJ promoter region A gel shift assay was performed to examine the direct interaction between the YdfI protein and the region upstream of ydfJ. We used a histidine-tagged YdfI protein (h-YdfI) in this analysis. The h-YdfI protein (224 aa; Mr 25 212) was expressed in the presence of IPTG (inducing conditions) in E. coli M15(pREP4, pQEYDFI), and purified by nickel-affinity chromatography (data not shown). An end-labelled DNA fragment (YDFJ-Pc, 170 bp) encompassing a region from 2154 to +6 bp with respect to the 59 end of ydfJ was used as a radioactive probe. In the presence of 6?25 pmol of h-YdfI, YDFJ-Pc exhibited a mobility shift (Fig. 4, lane 2). A clearer mobility shift of YDFJ-Pc was observed with an increase in the amount of h-YdfI. In the presence of 18?75 and 25 pmol of h-YdfI, almost all the probes formed a complex with h-YdfI (Fig. 4, lanes 4 and 5). Furthermore, we performed similar gel shift assays for 12 genes (ydfE, ydgJ, ydjM, pyrR, proH, ysbA, rbsR, lctE, yqxL, ywcJ, ywbH and cydA) that had been detected as candidate genes regulated by YdfHI as a result of DNA microarray analysis (Kobayashi et al., 2001). Although the regions upstream of the 12 genes were selected as putative promoter regions and gel shift assays were performed, no gel shift was found for any of the genes (data not shown). It may be that these 12 genes are related to YdfHI indirectly. In this analysis, we focused only on genes that were indicated to have a direct interaction with the YdfI response regulator; 1773
M. Serizawa and J. Sekiguchi
(a) ydfJ DIG-labelled RNA probe 168 1
2
YDFHIDSp 3
4
5
6
(b)
(c) ydfI DIG-labelled RNA probe _ IPTG: + 1
2
3
4
5
1
6
23S
23S 2.2 kb
16S 16S
ydfJ DIG-labelled RNA probe _ +
IPTG:
2.2 kb
2
3
4
5
6
23S 16S
0.6 kb
Fig. 3. (a) Northern blot analysis of ydfJ in strains 168 and YDFHIDSp. These strains were inoculated into 200 ml LB at an OD600 of 0?01. Cells were harvested at optical densities of approximately 0?4, 0?9 and 1?8 to allow isolation of total RNA. Twenty micrograms of each RNA was loaded onto 1 % (w/v) formaldehyde-agarose gels. Signals were detected with a DIG-labelled ydfJspecific RNA probe. The exposure time to the X-ray film (RX-U; Fujifilm) for detection was 1 h. Arrows and bars indicate the positions of mRNA signals and rRNAs, respectively. (b, c) Northern blot analysis of ydfI (b) and ydfJ (c) transcripts in YDFHIDSp harbouring plasmid pDG148ydfI, used for overexpression of ydfI. After inoculation of these strains into 200 ml LB medium containing kanamycin (10 mg ml”1) at an OD600 0?01, the cells were grown at 37 6C for 1 h. IPTG was added to one of the flasks at a final concentration of 1 mM, and the cells were harvested after 1, 1?5 and 2 h. Ten micrograms of each RNA was loaded onto 1 % (w/v) formaldehyde-agarose gels. Signals were detected with DIG-labelled ydfI- (b) and ydfJ- (c) specific RNA probes. The exposure times to the X-ray film (RX-U; Fujifilm) for detection were 10 s (b) and 10 min (c).
therefore, a detailed analysis was not performed for these 12 genes. The addition of excess amounts of the non-radioactive YDFJ-Pc fragment suppressed radioactively labelled YDFJ-Pc
complex formation (Fig. 4, lanes 6–9). These results suggest that complex formation between YDFJ-Pc and h-YdfI is caused by specific interaction. Moreover, h-YdfI did not bind to an unrelated 113 bp fragment PG3-MCS, which belongs to the multi-cloning site of pGEM-3Zf(+) (Fig. 4, lanes 10–12). Therefore, it seems reasonable to conclude that the formation of the complex between h-YdfI and YDFJ-Pc is specific.
Fig. 4. Gel shift assays of h-YdfI protein and YDFJ-Pc probe DNA including the ydfJ promoter region. Radioactively labelled YDFJ-Pc (0?025 pmol) (lanes 1–5) or PG3-MCS (lanes 10–12), and 4 mg poly(dI-dC) as the competitor DNA were incubated with different amounts of h-YdfI (lanes 1 and 10, 0 pmol; lane 2, 6?25 pmol; lanes 3 and 11, 12?5 pmol; lane 4, 18?75 pmol; lanes 5 and 12, 25 pmol). PG3-MCS was used as a negative control. A competition assay was performed with constant amounts of radioactively labelled YDFJ-Pc probe (0?025 pmol) and h-YdfI (25 pmol), and different amounts of nonlabelled YDFJ-Pc probe (lane 6, 2?5 pmol; lane 7, 5 pmol; lane 8, 7?5 pmol; lane 9, 10 pmol). 1774
Microbiology 151
The YdfHI system regulates ydfJ transcription
DNase I footprinting analysis of the interaction of h-YdfI with the ydfJ promoter region and primer extension analysis of ydfJ We carried out DNase I footprinting analysis to determine the h-YdfI-binding site(s), and primer extension analysis of ydfJ (Figs 5 and 6). Fig. 6 shows that the transcriptional initiation site of ydfJ is ‘G’ and we could not detect any other significant transcripts within the region of 144 bp upstream of the 59-end of ydfJ. These results suggest the putative
promoter sequences (235 and 210) of ydfJ are TTttCA and TAcAAT, respectively (capital letters indicating the sigma A consensus sequences). h-YdfI-protected sequences in both the coding and noncoding strands of the ydfJ promoter region are located just upstream of the putative ydfJ promoter sequence (235 and 210) (Figs 5 and 6). Moreover, we found the tandem repeat sequences, GCCCaAAcGTAC and GCCCgAAtGTAC, in the h-YdfI-protected region (from 267 to 235 bp with respect to the ydfJ transcriptional initiation site). The sequence GCCCRAAYGTAC, which is the putative recognition sequence of YdfI, was called the ‘YdfI-box’. The above result suggests that the direct binding of YdfI to the ydfJ promoter region regulates ydfJ transcription. Disk diffusion analysis for detecting sensitivity to various antibiotics Since YdfJ belongs the RND superfamily, there is a possibility that YdfJ is associated with resistance to antibiotics. Thus, we investigated the sensitivity to antibiotics of strains 168 (wild-type), YDFHIDSp (ydfHI null mutant) and YDFJDPM4 (ydfJ disruptant). Filter paper disks with 31 types of antibiotic, described in Methods, were used in this analysis. However, the results obtained were contrary to our expectations: no significant difference in sensitivity to the 31 types of antibiotic between the three strains (168, YDFHIDSp and YDFJDPM4) was detected (data not shown).
DISCUSSION
Fig. 5. DNase I footprinting analysis of ydfJ promoter region. The left and right panels are DNase I footprints of the 39-end-labelled coding (YDFJ-Pc) and noncoding (YDFJ-Pn) probe DNAs. Arrowheads and vertical lines on the right side of each panel indicate the enhanced cleavage sites and protected regions, respectively. The numbers are with respect to the ydfJ transcriptional initiation site. The amount of h-YdfI protein in lanes 1–6 was 0, 62?5, 125, 187?5, 250 and 0 pmol, respectively. Lanes G and A+G indicate Maxam–Gilbert sequence ladders. http://mic.sgmjournals.org
Based on the classification of sensor kinases (in terms of the sequence around the phosphorylated histidine) and response regulators (in terms of the sequence of the output domain), YdfH and YdfI have been classified into Class II and NarL groups, respectively (Fabret et al., 1999). The YdfH sensor kinase (407 aa; Mr 46 345) has five transmembrane domains in its N-terminal region, which suggests that YdfH is a membrane-anchored protein. The C-terminal region of YdfH consists of the His PTase (histidine phosphotransferase) domain. The YdfI response regulator (213 aa; Mr 23 826) consists of the PA (phosphorylated aspartate) domain in the N-terminal region, and an output domain in the C-terminal region. A gel shift was observed with the h-YdfI protein and a DNA fragment containing the upstream region of ydfJ (YDFJ-Pc). Since the molar ratio of h-YdfI to YDFJ-Pc for stable binding was more than 750 (Fig. 4), more efficient binding may be found after phosphorylation of h-YdfI with a chemical phosphodonor such as acetylphosphate. DNase I footprinting analysis revealed the region protected by h-YdfI (Fig. 5). The protected area was from 267 to 235 bp with respect to the ydfJ transcriptional initiation site (Fig. 6). We found two tandem repeat sequences consisting of conserved 12-mer sequences (YdfI-box; GCCCRAAYGTAC). Accordingly, we presume that the tandem repeat sequence is the putative YdfJ recognition sequence. It has 1775
M. Serizawa and J. Sekiguchi
Fig. 6. Summary of the results of DNase I footprinting and primer extension analyses. The nucleotide sequences of the coding and noncoding strands of the ydfJ promoter region are given. The region exhibiting affinity to h-YdfI is boxed in black. Two horizontal arrows with numbers denote the tandem repeat sequences consisting of the two conserved 12-mer sequences (GCCCRAAYGTAC). The numbers below the sequence are with respect to the ydfJ transcriptional initiation site. Converging arrowheads indicate the putative ydfI terminator. A potential ribosome-binding site (RBS) is denoted by an open box. Vertical arrowheads and a bar indicate the enhanced cleavage sites and the 39 end of ydfI, respectively. Putative ydfJ promoter sequences (”35 and ”10) are underlined. The ”35 region (TTTTCA) and ”10 region (TACAAT), with a gap of 13 bp, are similar to those of the sA consensus sequence (TTGACA for the ”35 region and TATAAT for the ”10 region, with a gap of 17 bp) (Haldenwang, 1995). ‘+1’ indicates the transcriptional initiation site of ydfJ detected by primer extension analysis. Total RNAs (40 mg) extracted from B. subtilis YDFHIDSp harbouring pDG148ydfI (grown in the presence of IPTG for overexpression of YdfI) were used as RNA samples (they were the same RNAs as used in Fig. 3c, lane 5). Signals were detected with 32P-labelled primer YDFJ-PEX, which was designed based on the sequence from +54 to +72 with respect to the 59-end of ydfJ. Dideoxy DNA sequencing reaction mixtures with the same primer were electrophoresed in parallel (lanes C, G, T and A) as size markers.
already been reported that in five systems (PhoPR, YxdJK, CitST, DctSR and LiaRS) of B. subtilis, tandem or direct repeat sequences are located within the target sites of their response regulators (DBTBS: http://dbtbs.hgc.jp/; Joseph et al., 2004; Yamamoto et al., 2000; Asai et al., 2000; Mascher et al., 2004). To find genes other than ydfJ regulated by YdfHI, a wholegenome sequence search was performed using the webbased software GRASP-DNA. Seq-1 (GCCCAAACGTAC) or seq-2 (GCCCGAATGTAC), which are found in the putative cis-acting regulatory sequences of ydfJ, were used as query sequences in the GRASP-DNA search. Then, we studied regions in which two or more query sequences existed in tandem in the region upstream of the genes detected in the GRASP-DNA search. Two sequences similar to the YdfI-box were found to exist in tandem within the region upstream of yfkC, when seq-2 was used as a query sequence. Moreover, 1776
the sA consensus sequence was found upstream of yfkC. If YdfHI controls yfkC, the monocistronic transcription of yfkC may be specifically induced by YdfI overexpression. Therefore, we performed Northern blot analysis of yfkC under YdfI overexpression conditions in ydfHI double null mutant YDFHIDSp. However, an mRNA signal corresponding to the monocistronic transcription of yfkC was not detected. Since YdfJ belongs to the RND superfamily, there is a possibility that YdfJ is associated with resistance to antibiotics. However, we have not yet found any antibiotics that have significant effects on YDFHIDSp (ydfHI null mutant) and YDFJDPM4 (ydfJ disruptant) strains. There may be an association between YdfJ and the transport of some noxious compounds (for example, heavy-metal ions and dyes) other than antibiotics. Moreover, it may be necessary to investigate the association between YdfJ and the transport Microbiology 151
The YdfHI system regulates ydfJ transcription
and biosynthesis of lipids. YdfJ belongs to the HAE2 family, which is a subfamily of the RND superfamily (Tseng et al., 1999). The HAE2 family is specific to Gram-positive bacteria and is involved in not only drug resistance but also the transport and biosynthesis of lipids (transport classification database; http://tcdb.ucsd.edu/tcdb/). For example, mmpL7 and mmpL8 of Mycobacterium tuberculosis are required for the efficient translocation of phthiocerol dimycocerosate (Camacho et al., 2001) and for sulfolipid-1 biosynthesis (Converse et al., 2003), respectively. CAC3431 of Clostridium acetobutylicum ATCC 824 shows a high amino acid sequence similarity with ydfJ (Smith– Waterman similarity score, 2026; identity 45?4 %). CAC3431, as well as ydfJ, belongs to the HAE2 family, and is predicted to function as a multidrug-efflux pump (transportDB; http://www.membranetransport.org/). Moreover, CAC3429 and CAC3430, which are located adjacent to CAC3431, have high amino acid sequence similarities to YdfI (response regulator) and YdfH (sensor kinase), respectively. Consequently, it is quite likely that CAC3431 is regulated by a two-component system consisting of CAC3429 and CAC3430 in C. acetobutylicum ATCC 824. The gene organization of C. acetobutylicum was similar to that of ydfH–ydfI (two-component system) and ydfJ (RND superfamily member), and it was the only case in the sequence similarity database (SSDB: 160 bacteria are currently registered). In this study, we have demonstrated that ydfJ of the RND superfamily is regulated by the YdfHI two-component system. YdfI (the response regulator) directly binds to the ydfJ promoter region, and tandem repeat sequences are present in the YdfI-binding site. However, we could not identify the signal recognized by the YdfH sensor kinase. Most RND superfamily members have a role in resistance to a wide range of noxious compounds. As a future study, it will be necessary to investigate the association between YdfJ and the transport of lipids, heavy-metal ions and dyes.
ACKNOWLEDGEMENTS We are grateful to M. Watanabe for the construction of pQEYDFI. We also thank H. Yamamoto and S. Tojo (Fukuyama University) for kind technical advice, and A. Chaki and K. Kodama for experimental assistance. For radioisotope and DNA sequence analyses, some equipment in the Gene Research Center of Shinshu University was used. This work was supported by a Grant-in-aid for Scientific Research on Priority Areas, Genome Biology (12206005) (to J. S.), Grant-in-aid for JSPS Fellows (15061544) (to M. S.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and JSPS Research Fellowships for Young Scientists (to M. S.) from the Japan Society for the Promotion of Science.
REFERENCES Aguilar, P. S., Hernandez-Arriaga, A. M., Cybulski, L. E., Erazo, A. C. & de Mendoza, D. (2001). Molecular basis of thermosensing: a two-
component signal transduction thermometer in Bacillus subtilis. EMBO J 20, 1681–1691. http://mic.sgmjournals.org
Asai, K., Baik, S. H., Kasahara, Y., Moriya, S. & Ogasawara, N. (2000). Regulation of the transport system for C4-dicarboxylic acids
in Bacillus subtilis. Microbiology 146, 263–271. Camacho, L. R., Constant, P., Raynaud, C., Laneelle, M. A., Triccas, J. A., Gicquel, B., Daffe, M. & Guilhot, C. (2001). Analysis of the
phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. Evidence that this lipid is involved in the cell wall permeability barrier. J Biol Chem 276, 19845–19854. Converse, S. E., Mougous, J. D., Leavell, M. D., Leary, J. A., Bertozzi, C. R. & Cox, J. S. (2003). MmpL8 is required for sulfolipid-1
biosynthesis and Mycobacterium tuberculosis virulence. Proc Natl Acad Sci U S A 100, 6121–6126. Doan, T., Servant, P., Tojo, S., Yamaguchi, H., Lerondel, G., Yoshida, K., Fujita, Y. & Aymerich, S. (2003). The Bacillus subtilis
ywkA gene encodes a malic enzyme and its transcription is activated by the YufL/YufM two component system in response to malate. Microbiology 149, 2331–2343. Fabret, C., Feher, V. A. & Hoch, J. A. (1999). Two-component signal
transduction in Bacillus subtilis: how one organism sees its world. J Bacteriol 181, 1975–1983. Fukuchi, K., Kasahara, Y., Asai, K., Kobayashi, K., Moriya, S. & Ogasawara, N. (2000). The essential two-component regulatory
system encoded by yycF and yycG modulates expression of the ftsAZ operon in Bacillus subtilis. Microbiology 146, 1573–1583. Grkovic, S., Brown, M. H. & Skurray, R. A. (2002). Regulation of
bacterial drug export systems. Microbiol Mol Biol Rev 66, 671–701. Haldenwang, W. G. (1995). The sigma factors of Bacillus subtilis.
Microbiol Rev 59, 1–30. Hulett, F. M. (1996). The signal-transduction network for Pho
regulation in Bacillus subtilis. Mol Microbiol 19, 933–939. Hyyrylainen, H. L., Bolhuis, A., Darmon, E. & 8 other authors (2001).
A novel two-component regulatory system in Bacillus subtilis for the survival of severe secretion stress. Mol Microbiol 41, 1159–1172. Ishikawa, S., Hara, Y., Ohnishi, R. & Sekiguchi, J. (1998). Regulation
of a new cell wall hydrolase gene, cwlF, which affects cell separation in Bacillus subtilis. J Bacteriol 180, 2549–2555. Joseph, P., Guiseppi, A., Sorokin, A. & Denizot, F. (2004). Charac-
terization of the Bacillus subtilis YxdJ response regulator as the inducer of expression for the cognate ABC transporter YxdLM. Microbiology 150, 2609–2617. Kobayashi, K., Ogura, M., Yamaguchi, H., Yoshida, K., Ogasawara, N., Tanaka, T. & Fujita, Y. (2001). Comprehensive DNA microarray
analysis of Bacillus subtilis two-component regulatory systems. J Bacteriol 183, 7365–7370. Mascher, T., Zimmer, S. L., Smith, T. A. & Helmann, J. D. (2004).
Antibiotic-inducible promoter regulated by the cell envelope stresssensing two-component system LiaRS of Bacillus subtilis. Antimicrob Agents Chemother 48, 2888–2896. Maxam, A. M. & Gilbert, W. (1977). A new method for sequencing
DNA. Proc Natl Acad Sci U S A 74, 560–564. Maxam, A. M. & Gilbert, W. (1980). Sequencing end-labeled DNA
with base-specific chemical cleavages. Methods Enzymol 65, 499–560. Msadek, T., Kunst, F. & Rapoport, G. (1995). A signal transduction
network in Bacillus subtilis includes the DegS/DegU and ComP/ ComA two-component systems. In Two-Component Signal Transduction, pp. 447–471. Edited by J. A. Hoch & T. J. Silhavy. Washington, DC: American Society for Microbiology. Ogura, M., Yamaguchi, H., Yoshida, K., Fujita, Y. & Tanaka, T. (2001). DNA microarray analysis of Bacillus subtilis DegU, ComA
and PhoP regulons: an approach to comprehensive analysis of B. subtilis two-component regulatory systems. Nucleic Acids Res 29, 3804–3813. 1777
M. Serizawa and J. Sekiguchi
Ohki, R., Giyanto, Tateno, K., Masuyama, W., Moriya, S., Kobayashi, K. & Ogasawara, N. (2003). The BceRS two-component regulatory
of aerobic and anaerobic respiration in Bacillus subtilis. J Bacteriol 178, 1374–1385.
system induces expression of the bacitracin transporter, BceAB, in Bacillus subtilis. Mol Microbiol 49, 1135–1144.
Tanaka, K., Kobayashi, K. & Ogasawara, N. (2003). The Bacillus subtilis
Schaeffer, P., Millet, J. & Aubert, J. P. (1965). Catabolic repression of
bacterial sporulation. Proc Natl Acad Sci U S A 54, 704–711. Schilling, C. H., Held, L., Torre, M. & Saier, M. H., Jr (2000). GRASP-
DNA: a web application to screen prokaryotic genomes for specific DNA-binding sites and repeat motifs. J Mol Microbiol Biotechnol 2, 495–500. Serizawa, M., Yamamoto, H., Yamaguchi, H., Fujita, Y., Kobayashi, K., Ogasawara, N. & Sekiguchi, J. (2004). Systematic analysis of
SigD-regulated genes in Bacillus subtilis by DNA microarray and Northern blotting analyses. Gene 329, 125–136.
YufLM two-component system regulates the expression of the malate transporters MeaN (YufR) and YflS, and is essential for utilization of malate in minimal medium. Microbiology 149, 2317–2329. Tekaia, F., Gordon, S. V., Garnier, T., Brosch, R., Barrell, B. G. & Cole, S. T. (1999). Analysis of the proteome of Mycobacterium
tuberculosis in silico. Tuber Lung Dis 79, 329–342. Tseng, T. T., Gratwick, K. S., Kollman, J., Park, D., Nies, D. H., Goffeau, A. & Saier, M. H., Jr (1999). The RND permease superfamily: an ancient,
ubiquitous and diverse family that includes human disease and development proteins. J Mol Microbiol Biotechnol 1, 107–125. Vagner, V., Dervyn, E. & Ehrlich, S. D. (1998). A vector for systematic
Stock, J. B., Surette, M. G., Levit, M. & Park, P. (1995). Two-
gene inactivation in Bacillus subtilis. Microbiology 144, 3097–3104.
component signal transduction systems: structure-function relationships and mechanisms of catalysis. In Two-Component Signal Transduction, pp. 25–52. Edited by J. A. Hoch & T. J. Silhavy. Washington, DC: American Society for Microbiology.
Yamamoto, H., Murata, M. & Sekiguchi, J. (2000). The CitST two-
Sun, G., Sharkova, E., Chesnut, R., Birkey, S., Duggan, M. F., Sorokin, A., Pujic, P., Ehrlich, S. D. & Hulett, F. M. (1996). Regulators
Organization and transcription of the myo-inositol operon, iol, of Bacillus subtilis. J Bacteriol 179, 4591–4598.
1778
component system regulates the expression of the Mg-citrate transporter in Bacillus subtilis. Mol Microbiol 37, 898–912. Yoshida, K., Aoyama, D., Ishio, I., Shibayama, T. & Fujita, Y. (1997).
Microbiology 151
