bioaugmentation for oily waste remediation: harm or
BIOAUGMENTATION FOR OILY WASTE REMEDIATION: HARM OR BENEFIT? L. BIKTASHEVA*, P. GALITSKAYA*, S. SELIVANOVSKAYA* *Department of Applied Ecology, Institute of environmental sciences, Kazan (Volga region) Federal University, Kazan, Russian Federation Correspondence to: P. Galitskaya ([email protected])
SUMMARY: Recently, biostimulation has often been used to remediate oily wastes. Use of additional bioaugmentation to increase biostimulation efficiency is widely discussed in scientific and practical literature. In this study, three methods of bioremediation for oily waste containing 177.8 g kg-1 of hydrocarbons were used: the first one included biostimulation with 66.6 % compost (w/w) made from municipal waste, the second one combined biostimulation and onetime inoculation by hydrocarbon degrading strains, and the third one combined biostimulation and repeated inoculation by hydrocarbon degrading strains (2 strains belonging to the species Rhodococcus jialingiae, the others - Stenotrophomonas rhizophila and Pseudomonas gessardii). It was found that hydrocarbon content decreased similarly in all three remediation mixtures, it fell twice during the first 63 days of investigation and then remained stable. Phytotoxicity after 150 days of investigation, expressed in GI, was equal to 104.7, 131.4 and 79.5 % in the first, second and third remediation mixtures, respectively. Bacterial as well as fungal counts were significantly higher in the first remediation mixture compared with the other two mixtures during the first 63 days of the experiment, while copy number of the alkB genes belonging to hydrocarbon degraders were significantly lower in this mixture. We suggest, that inoculation inhibited the indigenous microbial community in the remediation mixture, but consequent potential decrease in hydrocarbon decomposition rate was compensated by the high hydrocarbon degradation ability of the introduced strains.
1. INTRODUCTION The amounts and high hazard level of waste produced by the oil industry require development of new, safe and efficient methods for their treatment. Oily waste disposal fields represent a serious environmental problem in many countries including Russia. Often these wastes are hardly degradable because of high content of aromatics, resins and asphaltenes (Alexander 1999; Galitskaya et al. 2015; Macnaughton et al. 1999). Among many existing methods of oily waste treatment, biological methods represent a special group which has become more and more popular because of their high efficiency and environmental relevance (Chen et al. 2015; Agarwal & Liu 2015). Biostimulation is one of the methods of bioremediation that includes activation of indigenous microbial community in the waste by means of nutrient addition, reduction-oxidation potential or pH optimization etc. (Wu et al. 2017). Besides inorganic substrates, organic ones may also be
Proceedings Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium/ 2 - 6 October 2017 S. Margherita di Pula, Cagliari, Italy / © 2017 by CISA Publisher, Italy
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
used for biostimulation, e.g. sewage sludge or compost from municipal waste. In this case not only oil waste but also municipal organic waste may be simultaneously treated (Agamuthu et al. 2013; Zhang et al. 2011; Sayara et al. 2010). Bioaugmentation is another method of bioremediation, which includes introduction of hydrocarbon degrading microbes into the waste (D’Annibale et al. 2006; Thompson et al. 2005). Efficiency of bioaugmentation might be improved when multiple inoculations are used instead of a single one (Gilbert & Crowley 1998). This is because several inoculations support the development of populations of introduced species (Newcombe & Crowley 1999). Biostimulation and bioaugmentation are often compared by different authors, and the results of this comparison are very contradictory. Some authors suppose that bioaugmentation is not as efficient when compared with biostimulation (Fodelianakis et al. 2015; Li et al. 2009; Jiang et al. 2016; Wu et al. 2016). The reason being high competition between the indigenous and introduced species which do not survive (Macnaughton et al. 1999; Mao et al. 2012; Cappello et al. 2007; Tyagi et al. 2011; Dellagnezze et al. 2016). Another reason might be uncomfortable abiotic conditions of the new environments for introduced species (Mishra et al. 2001; Sarma et al. 2004; Simons et al. 2013). Some authors suppose that, on the other hand, bioaugmentation is more efficient, especially in the cases when the indigenous microbial community is very poor or absent (Wu et al. 2017; Liu et al. 2014). Summarizing data published on bioaugmentation and biostimulation, we can conclude that bioaugmentation is efficient when the oil pollution is very specific, e.g. when it contains high amounts of heavy degradable aromatics or asphalthenes in high concentrations, while biostimulation is suitable for oil pollutions containing different hydrocarbons including easily degradable ones in relatively low concentrations (Schwartz & Scow 2001). The example for the first case is long-time stored semisolid oily waste, and for the second – fresh oil polluted soil. Hydrocarbon degradation might be improved when biostimulation and bioaugmentation methods are used in combination (Taccari et al. 2012; Ouyang et al. 2005; Cerqueira et al. 2014; Hassanshahian et al. 2016). Such combination allows the decomposition of heavy degradable compounds such as fluoranthene and phenanthrene as well as to clean oil polluted soils (Uyttebroek et al. 2007; Benyahia & Embaby 2016). In some cases bioaugmentation improves biostimulation only during a particular period, e.g. in the beginning (Alexander 1999; Cai et al. 2016; Galitskaya et al. 2016). It can be concluded, that in practice each oil polluted site has to be treated in lab conditions before any method of bioremediation can be chosen and used. In the present study, three methods of bioremediation (I – biostimulation with compost from municipal solid wastes, II biostimulation in combination with single inoculation by hydrocarbon degrading strains, and III biostimulation in combination with multiple inoculation by hydrocarbon degrading strains) were used for treatment of oily waste, sampled in a refinery (Mari El, Russia). Efficiency of the methods was estimated using hydrocarbon content and phytotoxicity dynamics, and the microbial community was investigated in order to understand the mechanisms of the processes occurring in the waste. 2. MATERIALS AND METHODS 2.1. Experimental design The compost mixture was prepared using sawdust polluted by oil, the organic fraction of municipal solid waste, and semi-wet sludge from mixed industrial and household waste water
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
(1:2:6) sampled from the municipal solid waste landfill, Naberezhnye Chelny, Tatarstan, Russia (latitude: 55°42′28″N, longitude: 52°25′51″E). The proportion of the components was calculated in order to reach the optimal moisture content (between 55% and 65%) and C:N ratio (from 25 to 30). The compost was incubated for 270 days at room temperature and aerated by mixing daily. The moisture content of the compost was maintained at 55% to 60%. The oily waste used contained 177.8 g kg-1 total petroleum hydrocarbons (TPH). The oily waste was collected from a refinery, Mari El, Russia (latitude: 54°50′26″ N, longitude: 52°27′08″ E). Oily sludge and compost were mixed in a ratio 1:2. For additional bioaugmentation, this compost was inoculated with hydrocarbon degrading strains. Technically, the compost was divided into 3 parts, one of them was not inoculated (I), the second one was inoculated once (II), and the third one was inoculated three times (III). The inoculations were made in amounts of 108 CFU g-1 on the 1st (variant II), and 1st, 28th and 56th days (variant III) of bioremediation. Bioremediation was carried out at room temperature and by permanent mixing and maintaining the correct moisture level. Inoculation was carried out by a consortium consisting from four microbes (2 strains belonging to the species Rhodococcus jialingiae, the others - Stenotrophomonas rhizophila and Pseudomonas gessardii), which were previously isolated from the oily waste. The strains were cultivated for 7 days at 28⁰C and with a rotation of 130 rpm in a liquid medium with the following composition: (NH4)2SO4 – 1.0 g l-1, MgSO4 – 0.2 g l-1, KH2PO4 – 3.0 g l-1, Na2HPO4 – 4.5 g l-1; 2% of oil (v=v) was used as the sole carbon source. 2.2 Chemical and biological analyses Hydrocarbon content was estimated using IR-spectrometry with an AN-2 analyser (LLC Neftehimavtomatika-SPb, Russia). Phytotoxicity was estimated using oat plants (Avena sativa) via the contact method according to ISO 11269-1 (2012a) and ISO 11269-2 (2012b). Germination index (GI) was calculated as described by Zucconi et al. (1981) and used as a phytotoxicity parameter. GI (%) combined measurement of relative seed germination and relative root elongation. 2.3 Molecular analysis Total genomic DNA was extracted from the samples using the FastDNA®SPIN Kit for Soil (Bio101, Qbiogene, Heidelberg, Germany) according to the manufacturer’s instructions. The DNA samples were stored at -20 °C or analyzed immediately. Quantitative polymerase chain reaction (qPCR) was conducted using 16S 984f /1378r primers for bacteria, and ITS1/ITS2 for fungal assay (Heuer et al. 1997; Nübel et al. 1996; White et al. 1990). PCR reactions were conducted with a 0.1 U µl-1 SynTaq Polymerase, 1x Buffer with SYBR Green, 2.5 mM MgCl2, 200 µM dNTPs each, 0.2 µM primer each and 1 µl of DNA template in the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Munich, Germany). The qPCR program consisted of initial denaturation at 95 ⁰C for 5 min followed by 39 three-step cycles of 62–60 ⁰C for 45 s, 95 ⁰C for 15 s, and 72 ⁰C for 30 s. The standard curves were generated for bacteria using serial DNA dilutions of DNA of Bacillus pumilus and Penicillium chrysogenum. The concentration of bacterial and fungal DNA was measured on a Qubit 2.0 Fluorometer (Invitrogen, Thermo Fisher Scientific, Waltham, Massachusetts, USA) using the Picogreen ds DNA reagent (Invitrogen Ltd., Paisley, UK). The copy number of the alkB gene in each sample was quantified with qPCR analysis. Real-
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
time PCR was performed using a 0.1 U µl-1 SynTaq Polymerase, 1x Buffer with SYBR Green, 2.5 mM MgCl2, 200 µM dNTPs each, 0.2 µM primer each and 1 µl of DNA template in the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Munich, Germany). qPCR assays were performed with the group-specific alkB primers listed in Table 1. The primers for Stenotrophomonas spp. were designed based on the available draft genomes using Primer— BLAST tool from NCBI and assessed by Oligo 6 software. PCR amplification was conducted using the following protocol: 15 min at 95 C ̊ , followed by 39 cycles at 95 ̊C for 30 s, 30 s at Tm shown in Table 1, and 30 s at 72 ̊C. The reference strains from each group-specific alkB gene were Rh. jialingiae, S. rhizophila, Ps. gessardii. Cycle thresholds were determined by comparison with standard curves constructed using several concentrations of a positive clone. The plasmid DNA concentration was determined on a Qubit 2.0 Fluorometer, and the copy number of the target gene was calculated directly from the concentration of the extracted plasmid DNA. Ten-fold serial dilutions of a known copy number of plasmid DNA were subjected to real-time PCR in five replicates to generate an external standard curve. Three replicates for each sample were used for qPCR analyzes. All of qPCR assays performed with efficiency of more than 94%, R2 values greater than 0.99. Table 1. Group-Specific alkB primers used in this study Tm (°C) Primers R1f438 R1r835 GPf519 GPr744 Stf556 Stf712
Sequence (5’-3’) CGTCGAGCGCTGGTTGTCC GACGTAGGAGTCCGTAGTGC CACCGTGATGTIGCTACACCG GGAACACCAGCATCTTIGG TGAGTGACGAACACGGCTAC TAATGGTTGACCAGGCAGGC
54
Phylogenetic affiliation Rhodococcus spp.
54
Pseudomonas spp.
60
Stenotrophomonas spp
References (Hamamura et al. 2008) (Hamamura et al. 2008) -
2.4 Statistical analysis Sampling and chemical analyses were carried out in triplicate and biological analyses in quintuplicate, and all results were expressed on an air-dried sample basis. Statistical analyses were performed using Origin 8.0 (OriginLab, Northampton, USA) and R Statistical Software (R 3.0.0, R Foundation for Statistical Computing Version, Vienna, Austria) packages. The confidence of data generated in the present investigations has been analyzed by standard statistical methods to determine the mean values and standard errors (SEs). The means were compared using Fisher’s least significant difference at α=0.05. The values in figures were expressed as mean ±SE of the corresponding replicates. 3. RESULTS AND DISCUSSION 3.1 Hydrocarbon content dynamics in the process of bioremediation Hydrocarbons are one of the main factors which determine the environmental hazard of oily wastes. Therefore, changes of hydrocarbon content are important to monitor waste remediation efficiency. TPH content dynamics in the oily waste remediated using 3 methods are presented in Fig. 1.
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Fig.1. TPH content dynamics in the process of bioremediation. As shown on Fig.1, TPH content did not differ significantly between samples I, II and III representing the 3 methods of bioremediation. At the beginning of the process, it was about 50 g kg-1, then it fluctuated up to day 63 and later remained stable. At the end of bioremediation, TPH content had decreased by about 1.8-1.9 times in all three samples. This decrease may be defined as an effective one as compared with other published data (Zhang et al. 2011; Wu et al. 2017). In terms of hydrocarbon content, bioaugmentation did not cause any additional effect on biostimulation. Most likely, indigenous waste microbes have the ability to degrade hydrocarbons, and the addition of compost intensifies this process due to several mechanisms: first, the concentration of hydrocarbon in the initial waste falls due to simple dilution; second, compost contains nutrients needed for hydrocarbon degraders, e.g. nitrogen; and third compost serves as a structural agent for oily waste, it improves the waste’s aeration. This is in line with other works where authors did not observe additional effects of bioaugmentation in their investigations (Li et al. 2009; Jiang et al. 2016; Wu et al. 2016; Kauppi et al. 2011). Fodelianakis with coauthors (2015) demonstrated that indigenous microorganisms, but not the introduced ones, played a more important role in the bioremediation of the oily waste. Liu et al. (2014) even found that bioaugmentation may decrease the positive effect of biostimulation. 3.2 Phytotoxicity dynamics in the process of bioremediation Besides hydrocarbon content dynamics, toxicity of oily waste is commonly used as an indicator of bioremediation efficiency (Morelli et al. 2005; Pelletier et al. 2004). In the literature, bioassays with aquatic organisms as well as with terrestrial higher plants are often used. In our investigation, we used a contact plant bioassay supposing that a contact test is more suitable for toxicity estimation of non-water soluble pollutants such as hydrocarbons as compared with elutriate one, such as a conventional bioassay with daphnids or infusoria (Selivanovskaya & Galitskaya 2011). With one and the same TPH content toxicity of the waste may be different, because TPH are a mixture of hydrocarbons of different sizes, structures and toxicity, therefore toxicity estimation may give additional information about bioremediation process (Reddy et al. 2011; Kriipsalu & Nammari 2010; Saterbak et al. 2000). Results of phytotoxicity estimation expressed in GI are presented in Fig. 2.
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Fig. 2. Phytotoxicity dynamics in the process of bioremediation As shown in the figure, the GI of oily waste remediated using method I without microbial inoculation increases from the beginning of remediation up to day 90, then decreases up to 120 day and then raises. Fluctuations of phytotoxicity may be explained by partial degradation of oil hydrocarbons with formation of toxic metabolites. Most likely, after day 90, these metabolites are appeared and later (after the 120 day) utilized by microbes and therefore oily waste becomes to be less toxic. Fluctuations of oily waste toxicity in the process of hydrocarbon biodegradation have been described by other authors previously (Morelli et al. 2001). On day 150 the GI exceeds 100% in the remediation mixture I, which means that the remediated oily waste has become not hazardous, but stimulating, for plants. Inoculation of the remediation mixture by hydrocarbon degrading strains led to the following results. First, desynchronization of phytotoxicity fluctuations with no significant changes of GI level was observed. Such a type of response in the microbial community changes was observed earlier and described in our previous works (Selivanovskaya et al. 2008). Second, at the end of bioremediation, the GI in the inoculated remediation mixtures differed slightly but in a statistically significant way from that in the non-inoculated mixture: it was higher in the remediation mixture I and lower in the remediation mixture III. This means that additional bioaugmentation affects bioremediation efficiency in terms of phytotoxicity, but the effect is not strong and has no dose-response effects. 3.3 Microbial counts dynamics in the process of bioremediation Microbes are the driving force of hydrocarbon biodegradation in the process of bioremediation (Galitskaya et al. 2016). Changes of TPH content and phytotoxicity described in the previous paragraphs happen because of microbial processes going on in the remediation mixtures. In our study, we estimated microbial community status using bacterial and fungal counts as well as specific hydrocarbon degradation encoding genes copy numbers. As shown in Fig. 3a, the maximal bacterial copy number was observed in the remediation mixture I between the 10thand 36th days, when it ranged between 1.5-4.0х109 per gram of mixture. Bacterial gene copy number is significantly higher in the non-inoculated remediation mixture compared with the inoculated ones during the first 63 days of experiment. That means that, first, inoculation did not lead to active growth of bacterial communities, which can be explained by comparatively low
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
number of bacterial cells in the inoculate (about 108) in comparison with total bacterial counts (109) and low survival rate of introduced bacteria. And second, that introduced strains inhibited the indigenous community in terms of bacterial counts. After 60 days, bacterial copy number remained stable and low in line with the TPH content described above. a
b
Fig. 3. Bacterial (a) and fungal (b) copy number dynamics in the process of bioremediation. Fungal gene copy number had similar dynamics: in the non-inoculated remediation mixture there were significantly more fungi than in the inoculated ones before day 63, and in all three mixtures low and stable counts of fungi were observed after day 63 (Fig. 3b). Most likely, this fact may be explained by competitive pressure that introduced bacterial strains exert on the indigenous bacterial and fungal ones. Colombo with co-authors (2011) demonstrated this phenomenon in oily polluted soil . Overall, fungal gene copy numbers were 103-fold lower than bacterial ones, which is in line with data presented in the literature (Wang et al. 2012; Lang et al. 2000). Thus, microbial counts became lower after bacterial inoculation and, at the same time,
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
bioremediation efficiency did not change. We suggest that this is due to enlarged amounts of hydrocarbon degraders in mixtures II and III which compensate for the total bacterial and fungal count fall. In order to check this hypothesis, we estimated in the remediation mixtures copy numbers of specific hydrocarbon degrading alkB-genes belonging to Rhodococcus, Pseudomonas and Stenotrophomonas taxa. Bacterial strains belonging to these taxa were present in the inoculation. a
b
c
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Fig.4. Copy number of the alkB genes in samples II and III (a- Rhodococcus spp.; b – Pseudomonas spp.; c – Stenotrophomonas spp.). As shown in the Fig. 4a-c, the gene copy numbers of all three alkB genes were stable during the process of bioremediation in mixture I. On the contrary, in inoculated mixtures II and III it changed significantly over time. For all three alkB genes, significant increase of gene copy numbers was observed on the day of inoculation. Interestingly, that after the first inoculation gene copy numbers first increased and then fell, and after the second and third inoculation – fell without any growth. This difference may be explained by higher stability of the community by day 28 when the second and third inoculations were made and consequently lower survival rate of the introduced bacteria. The data described above show that our hypothesis was right, and that introduction of populations of hydrocarbon degraders, on the one hand, inhibit indigenous microbes, and therefore, most likely, decrease the initial TPH biodegradation rate, but on the other hand, efficiently decompose hydrocarbons by themselves and compensate, through this, the TPH biodegradation rate. 4. CONCLUSION In this work, three methods of bioremediation of oily waste produced in a refinery (Mari El, Russia) were implemented. All three methods included biostimulation with compost and two methods additionally included bioaugmentation. All three methods had the same efficiency in terms of TPH level declination and comparative efficiency in terms of phytotoxicity. Two methods that included bacterial inoculation of remediated mixture led to a decrease of bacterial and fungal counts and a simultaneous increase of hydrocarbon degrading species populations. Most likely, these two processes compensated each other which resulted in no differences in bioremediation efficiency. From a practical point of view, biostimulation without bioaugmentation may be recommended as the simplest of the methods checked. ACKNOWLEDGEMENT The work is performed according to the Russian Government Program of Competitive Growth of Kazan Federal University. The research was performed using the equipment of
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Interdisciplinary Center for Shared Use of Kazan Federal University. REFERENCES Agamuthu, P., Tan, Y.S. & Fauziah, S.H., 2013. Bioremediation of Hydrocarbon Contaminated Soil Using Selected Organic Wastes. Procedia Environmental Sciences, 18, pp.694–702. Available at: http://linkinghub.elsevier.com/retrieve/pii/S1878029613002260. Agarwal, A. & Liu, Y., 2015. Remediation technologies for oil-contaminated sediments. Marine Pollution Bulletin, 101(2), pp.483–490. Alexander, M., 1999. Bioremediation and Biodegradation. Focus, 32, pp.1126–1133. 2012a. ISO 11269-1:2012 Soil quality -- Determination of the effects of pollutants on soil flora -Part 1: Method for the measurement of inhibition of root growth. , p.16. 2012b. ISO 11269-2:2012 Soil quality -- Determination of the effects of pollutants on soil flora -Part 2: Effects of contaminated soil on the emergence and early growth of higher plants. , p.19. Benyahia, F. & Embaby, A.S., 2016. Bioremediation of crude oil contaminated desert soil: Effect of biostimulation, bioaugmentation and bioavailability in biopile treatment systems. International Journal of Environmental Research and Public Health, 13(2). Cai, B. et al., 2016. Comparison of phytoremediation, bioaugmentation and natural attenuation for remediating saline soil contaminated by heavy crude oil. Biochemical Engineering Journal, 112, pp.170–177. Cappello, S. et al., 2007. Microbial community dynamics during assays of harbour oil spill bioremediation: A microscale simulation study. Journal of Applied Microbiology, 102(1), pp.184– 194. Cerqueira, V.S. et al., 2014. Comparison of bioremediation strategies for soil impacted with petrochemical oily sludge. International Biodeterioration and Biodegradation, 95(PB), pp.338– 345. Chen, M. et al., 2015. Bioremediation of soils contaminated with polycyclic aromatic hydrocarbons, petroleum, pesticides, chlorophenols and heavy metals by composting: Applications, microbes and future research needs. Biotechnology Advances, 33(6), pp.745–755. Colombo, M. et al., 2011. Bioremediation of polyaromatic hydrocarbon contaminated soils by native microflora and bioaugmentation with Sphingobium chlorophenolicum strain C3R: A feasibility study in solid- and slurry-phase microcosms. International Biodeterioration and Biodegradation, 65(1), pp.191–197. D’Annibale, A. et al., 2006. Role of autochthonous filamentous fungi in bioremediation of a soil historically contaminated with aromatic hydrocarbons. Applied and Environmental Microbiology, 72(1), pp.28–36. Dellagnezze, B.M. et al., 2016. Bioaugmentation strategy employing a microbial consortium immobilized in chitosan beads for oil degradation in mesocosm scale. Marine Pollution Bulletin, 107(1), pp.107–117. Fodelianakis, S. et al., 2015. Allochthonous bioaugmentation in ex situ treatment of crude oilpolluted sediments in the presence of an effective degrading indigenous microbiome. Journal of Hazardous Materials, 287, pp.78–86. Galitskaya, P. et al., 2015. Response of soil microorganisms to radioactive oil waste: results from a leaching experiment. Biogeosciences, 12, pp.3681–3693. Galitskaya, P., Akhmetzyanova, L. & Selivanovskaya, S., 2016. Biochar-carrying hydrocarbon decomposers promote degradation during the early stage of bioremediation. Biogeosciences, 13(20), pp.5739–5752.
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Gilbert, E.S. & Crowley, D.E., 1998. Repeated application of carvone-induced bacteria to enhance biodegradation of polychlorinated biphenyls in soil. Applied Microbiology and Biotechnology, 50(4), pp.489–494. Hamamura, N. et al., 2008. Assessing soil microbial populations responding to crude-oil amendment at different temperatures using phylogenetic, functional gene (alkB) and physiological analyses. Environmental Science and Technology, 42(20), pp.7580–7586. Hassanshahian, M. et al., 2016. Comparison the effects of bioaugmentation versus biostimulation on marine microbial community by PCR-DGGE: A mesocosm scale. Journal of Environmental Sciences (China), 43, pp.136–146. Heuer, H. et al., 1997. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. Applied and Environmental Microbiology, 63(8), pp.3233–3241. Jiang, Y. et al., 2016. Insights into the biodegradation of weathered hydrocarbons in contaminated soils by bioaugmentation and nutrient stimulation. Chemosphere, 161, pp.300– 307. Kauppi, S., Sinkkonen, A. & Romantschuk, M., 2011. Enhancing bioremediation of diesel-fuelcontaminated soil in a boreal climate: Comparison of biostimulation and bioaugmentation. International Biodeterioration and Biodegradation, 65(2), pp.359–368. Kriipsalu, M. & Nammari, D., 2010. Monitoring of biopile composting of oily sludge. Waste Management & Research, 28(5), pp.395–403. Available at: http://journals.sagepub.com/doi/10.1177/0734242X09337749. Lang, E., Kleeberg, I. & Zadrazil, F., 2000. Extractable organic carbon and counts of bacteria near the lignocellulose-soil interface during the interaction of soil microbiota and white rot fungi. Bioresource Technology, 75(1), pp.57–65. Li, X. et al., 2009. Biodegradation of the low concentration of polycyclic aromatic hydrocarbons in soil by microbial consortium during incubation. Journal of Hazardous Materials, 172(2–3), pp.601–605. Liu, P.W.G. et al., 2014. Bioaugmentation efficiency investigation on soil organic matters and microbial community shift of diesel-contaminated soils. International Biodeterioration and Biodegradation, 95(PA), pp.276–284. Macnaughton, S.J. et al., 1999. Microbial population changes during bioremediation of an experimental oil spill. Applied and Environmental Microbiology, 65(8), pp.3566–3574. Mao, J. et al., 2012. Bioremediation of polycyclic aromatic hydrocarbon-contaminated soil by a bacterial consortium and associated microbial community changes. International Biodeterioration and Biodegradation, 70, pp.141–147. Mishra, S. et al., 2001. In situ bioremediation potential of an oily sludge-degrading bacterial consortium. Current Microbiology, 43(5), pp.328–335. Morelli, I.S. et al., 2001. Effect of petrochemical sludge concentrations on changes in mutagenic activity during soil bioremediation process. Environmental Toxicology and Chemistry, 20(10), pp.2179–2183. Available at: http://dx.doi.org/10.1002/etc.5620201007. Morelli, I.S. et al., 2005. Laboratory study on the bioremediation of petrochemical sludgecontaminated soil. International Biodeterioration and Biodegradation, 55(4), pp.271–278. Newcombe, D.A. & Crowley, D.E., 1999. Bioremediation of atrazine-contaminated soil by repeated applications of atrazine-degrading bacteria. Applied Microbiology and Biotechnology, 51(6), pp.877–882. Nübel, U. et al., 1996. Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis. Journal of Bacteriology,
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
178(19), pp.5636–5643. Ouyang, W. et al., 2005. Comparison of bio-augmentation and composting for remediation of oily sludge: A field-scale study in China. Process Biochemistry, 40(12), pp.3763–3768. Available at: http://www.sciencedirect.com/science/article/pii/S1359511305002564 [Accessed June 10, 2017]. Pelletier, E., Delille, D. & Delille, B., 2004. Crude oil bioremediation in sub-Antarctic intertidal sediments: Chemistry and toxicity of oiled residues. Marine Environmental Research, 57(4), pp.311–327. Reddy, M.V. et al., 2011. Aerobic remediation of petroleum sludge through soil supplementation: Microbial community analysis. Journal of Hazardous Materials, 197, pp.80– 87. Sarma, P.M. et al., 2004. Degradation of polycyclic aromatic hydrocarbons by a newly discovered enteric bacterium, Leclercia adecarboxylata. Applied and Environmental Microbiology, 70(5), pp.3163–3166. Saterbak, A.N.N. et al., 2000. Ecotoxicological and analytical assessment of effects of bioremediation on hydrocarbon-containing soils. Environmental Toxicology and Chemistry, 19(11), pp.2643–2652. Sayara, T., Sarrà, M. & Sánchez, A., 2010. Effects of compost stability and contaminant concentration on the bioremediation of PAHs-contaminated soil through composting. Journal of Hazardous Materials, 179(1–3), pp.999–1006. Schwartz, E. & Scow, K.M., 2001. Repeated inoculation as a strategy for the remediation of low concentrations of phenanthrene in soil. Biodegradation, 12(3), pp.201–207. Selivanovskaya, S.Y. & Galitskaya, P.Y., 2011. Ecotoxicological assessment of soil using the Bacillus pumilus contact test. European Journal of Soil Biology, 47(2), pp.165–168. Selivanovskaya, S.Y., Kuritsin, I.N. & Schnel, S., 2008. Influence of non-traditional soil improvers on nitrogenase and respiratory activity of gray forest soil (in Russian). In coll. articles Fundamental achievements in soil science, ecology, agriculture on the way to innovation. Moscow, pp. 82–85. Simons, K.L. et al., 2013. Carrier mounted bacterial consortium facilitates oil remediation in the marine environment. Bioresource Technology, 134, pp.107–116. Taccari, M. et al., 2012. Effects of biostimulation and bioaugmentation on diesel removal and bacterial community. International Biodeterioration and Biodegradation, 66(1), pp.39–46. Thompson, I.P. et al., 2005. Bioaugmentation for bioremediation: The challenge of strain selection. Environmental Microbiology, 7(7), pp.909–915. Tyagi, M., da Fonseca, M.M.R. & de Carvalho, C.C.C.R., 2011. Bioaugmentation and biostimulation strategies to improve the effectiveness of bioremediation processes. Biodegradation, 22(2), pp.231–241. Uyttebroek, M. et al., 2007. Characterization of cultures enriched from acidic polycyclic aromatic hydrocarbon-contaminated soil for growth on pyrene at low pH. Applied and Environmental Microbiology, 73(10), pp.3159–3164. Wang, S. et al., 2012. Case study of the relationship between fungi and bacteria associated with high-molecular-weight polycyclic aromatic hydrocarbon degradation. Journal of Bioscience and Bioengineering, 113(5), pp.624–630. White, T.J. et al., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, pp.315–322. Wu, M. et al., 2016. Bioaugmentation and biostimulation of hydrocarbon degradation and the microbial community in a petroleum-contaminated soil. International Biodeterioration and
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Biodegradation, 107, pp.158–164. Wu, M. et al., 2017. Bioremediation of hydrocarbon degradation in a petroleum-contaminated soil and microbial population and activity determination. Chemosphere, 169, pp.124–130. Zhang, Y. et al., 2011. Remediation of polycyclic aromatic hydrocarbon (PAH) contaminated soil through composting with fresh organic wastes. Environmental Science and Pollution Research, 18(9), pp.1574–1584. Zucconi, F. et al., 1981. Biological evaluation of compost maturity. BioCycle, 22(4), pp.27–29.
SUMMARY: Recently, biostimulation has often been used to remediate oily wastes. Use of additional bioaugmentation to increase biostimulation efficiency is widely discussed in scientific and practical literature. In this study, three methods of bioremediation for oily waste containing 177.8 g kg-1 of hydrocarbons were used: the first one included biostimulation with 66.6 % compost (w/w) made from municipal waste, the second one combined biostimulation and onetime inoculation by hydrocarbon degrading strains, and the third one combined biostimulation and repeated inoculation by hydrocarbon degrading strains (2 strains belonging to the species Rhodococcus jialingiae, the others - Stenotrophomonas rhizophila and Pseudomonas gessardii). It was found that hydrocarbon content decreased similarly in all three remediation mixtures, it fell twice during the first 63 days of investigation and then remained stable. Phytotoxicity after 150 days of investigation, expressed in GI, was equal to 104.7, 131.4 and 79.5 % in the first, second and third remediation mixtures, respectively. Bacterial as well as fungal counts were significantly higher in the first remediation mixture compared with the other two mixtures during the first 63 days of the experiment, while copy number of the alkB genes belonging to hydrocarbon degraders were significantly lower in this mixture. We suggest, that inoculation inhibited the indigenous microbial community in the remediation mixture, but consequent potential decrease in hydrocarbon decomposition rate was compensated by the high hydrocarbon degradation ability of the introduced strains.
1. INTRODUCTION The amounts and high hazard level of waste produced by the oil industry require development of new, safe and efficient methods for their treatment. Oily waste disposal fields represent a serious environmental problem in many countries including Russia. Often these wastes are hardly degradable because of high content of aromatics, resins and asphaltenes (Alexander 1999; Galitskaya et al. 2015; Macnaughton et al. 1999). Among many existing methods of oily waste treatment, biological methods represent a special group which has become more and more popular because of their high efficiency and environmental relevance (Chen et al. 2015; Agarwal & Liu 2015). Biostimulation is one of the methods of bioremediation that includes activation of indigenous microbial community in the waste by means of nutrient addition, reduction-oxidation potential or pH optimization etc. (Wu et al. 2017). Besides inorganic substrates, organic ones may also be
Proceedings Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium/ 2 - 6 October 2017 S. Margherita di Pula, Cagliari, Italy / © 2017 by CISA Publisher, Italy
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
used for biostimulation, e.g. sewage sludge or compost from municipal waste. In this case not only oil waste but also municipal organic waste may be simultaneously treated (Agamuthu et al. 2013; Zhang et al. 2011; Sayara et al. 2010). Bioaugmentation is another method of bioremediation, which includes introduction of hydrocarbon degrading microbes into the waste (D’Annibale et al. 2006; Thompson et al. 2005). Efficiency of bioaugmentation might be improved when multiple inoculations are used instead of a single one (Gilbert & Crowley 1998). This is because several inoculations support the development of populations of introduced species (Newcombe & Crowley 1999). Biostimulation and bioaugmentation are often compared by different authors, and the results of this comparison are very contradictory. Some authors suppose that bioaugmentation is not as efficient when compared with biostimulation (Fodelianakis et al. 2015; Li et al. 2009; Jiang et al. 2016; Wu et al. 2016). The reason being high competition between the indigenous and introduced species which do not survive (Macnaughton et al. 1999; Mao et al. 2012; Cappello et al. 2007; Tyagi et al. 2011; Dellagnezze et al. 2016). Another reason might be uncomfortable abiotic conditions of the new environments for introduced species (Mishra et al. 2001; Sarma et al. 2004; Simons et al. 2013). Some authors suppose that, on the other hand, bioaugmentation is more efficient, especially in the cases when the indigenous microbial community is very poor or absent (Wu et al. 2017; Liu et al. 2014). Summarizing data published on bioaugmentation and biostimulation, we can conclude that bioaugmentation is efficient when the oil pollution is very specific, e.g. when it contains high amounts of heavy degradable aromatics or asphalthenes in high concentrations, while biostimulation is suitable for oil pollutions containing different hydrocarbons including easily degradable ones in relatively low concentrations (Schwartz & Scow 2001). The example for the first case is long-time stored semisolid oily waste, and for the second – fresh oil polluted soil. Hydrocarbon degradation might be improved when biostimulation and bioaugmentation methods are used in combination (Taccari et al. 2012; Ouyang et al. 2005; Cerqueira et al. 2014; Hassanshahian et al. 2016). Such combination allows the decomposition of heavy degradable compounds such as fluoranthene and phenanthrene as well as to clean oil polluted soils (Uyttebroek et al. 2007; Benyahia & Embaby 2016). In some cases bioaugmentation improves biostimulation only during a particular period, e.g. in the beginning (Alexander 1999; Cai et al. 2016; Galitskaya et al. 2016). It can be concluded, that in practice each oil polluted site has to be treated in lab conditions before any method of bioremediation can be chosen and used. In the present study, three methods of bioremediation (I – biostimulation with compost from municipal solid wastes, II biostimulation in combination with single inoculation by hydrocarbon degrading strains, and III biostimulation in combination with multiple inoculation by hydrocarbon degrading strains) were used for treatment of oily waste, sampled in a refinery (Mari El, Russia). Efficiency of the methods was estimated using hydrocarbon content and phytotoxicity dynamics, and the microbial community was investigated in order to understand the mechanisms of the processes occurring in the waste. 2. MATERIALS AND METHODS 2.1. Experimental design The compost mixture was prepared using sawdust polluted by oil, the organic fraction of municipal solid waste, and semi-wet sludge from mixed industrial and household waste water
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
(1:2:6) sampled from the municipal solid waste landfill, Naberezhnye Chelny, Tatarstan, Russia (latitude: 55°42′28″N, longitude: 52°25′51″E). The proportion of the components was calculated in order to reach the optimal moisture content (between 55% and 65%) and C:N ratio (from 25 to 30). The compost was incubated for 270 days at room temperature and aerated by mixing daily. The moisture content of the compost was maintained at 55% to 60%. The oily waste used contained 177.8 g kg-1 total petroleum hydrocarbons (TPH). The oily waste was collected from a refinery, Mari El, Russia (latitude: 54°50′26″ N, longitude: 52°27′08″ E). Oily sludge and compost were mixed in a ratio 1:2. For additional bioaugmentation, this compost was inoculated with hydrocarbon degrading strains. Technically, the compost was divided into 3 parts, one of them was not inoculated (I), the second one was inoculated once (II), and the third one was inoculated three times (III). The inoculations were made in amounts of 108 CFU g-1 on the 1st (variant II), and 1st, 28th and 56th days (variant III) of bioremediation. Bioremediation was carried out at room temperature and by permanent mixing and maintaining the correct moisture level. Inoculation was carried out by a consortium consisting from four microbes (2 strains belonging to the species Rhodococcus jialingiae, the others - Stenotrophomonas rhizophila and Pseudomonas gessardii), which were previously isolated from the oily waste. The strains were cultivated for 7 days at 28⁰C and with a rotation of 130 rpm in a liquid medium with the following composition: (NH4)2SO4 – 1.0 g l-1, MgSO4 – 0.2 g l-1, KH2PO4 – 3.0 g l-1, Na2HPO4 – 4.5 g l-1; 2% of oil (v=v) was used as the sole carbon source. 2.2 Chemical and biological analyses Hydrocarbon content was estimated using IR-spectrometry with an AN-2 analyser (LLC Neftehimavtomatika-SPb, Russia). Phytotoxicity was estimated using oat plants (Avena sativa) via the contact method according to ISO 11269-1 (2012a) and ISO 11269-2 (2012b). Germination index (GI) was calculated as described by Zucconi et al. (1981) and used as a phytotoxicity parameter. GI (%) combined measurement of relative seed germination and relative root elongation. 2.3 Molecular analysis Total genomic DNA was extracted from the samples using the FastDNA®SPIN Kit for Soil (Bio101, Qbiogene, Heidelberg, Germany) according to the manufacturer’s instructions. The DNA samples were stored at -20 °C or analyzed immediately. Quantitative polymerase chain reaction (qPCR) was conducted using 16S 984f /1378r primers for bacteria, and ITS1/ITS2 for fungal assay (Heuer et al. 1997; Nübel et al. 1996; White et al. 1990). PCR reactions were conducted with a 0.1 U µl-1 SynTaq Polymerase, 1x Buffer with SYBR Green, 2.5 mM MgCl2, 200 µM dNTPs each, 0.2 µM primer each and 1 µl of DNA template in the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Munich, Germany). The qPCR program consisted of initial denaturation at 95 ⁰C for 5 min followed by 39 three-step cycles of 62–60 ⁰C for 45 s, 95 ⁰C for 15 s, and 72 ⁰C for 30 s. The standard curves were generated for bacteria using serial DNA dilutions of DNA of Bacillus pumilus and Penicillium chrysogenum. The concentration of bacterial and fungal DNA was measured on a Qubit 2.0 Fluorometer (Invitrogen, Thermo Fisher Scientific, Waltham, Massachusetts, USA) using the Picogreen ds DNA reagent (Invitrogen Ltd., Paisley, UK). The copy number of the alkB gene in each sample was quantified with qPCR analysis. Real-
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
time PCR was performed using a 0.1 U µl-1 SynTaq Polymerase, 1x Buffer with SYBR Green, 2.5 mM MgCl2, 200 µM dNTPs each, 0.2 µM primer each and 1 µl of DNA template in the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Munich, Germany). qPCR assays were performed with the group-specific alkB primers listed in Table 1. The primers for Stenotrophomonas spp. were designed based on the available draft genomes using Primer— BLAST tool from NCBI and assessed by Oligo 6 software. PCR amplification was conducted using the following protocol: 15 min at 95 C ̊ , followed by 39 cycles at 95 ̊C for 30 s, 30 s at Tm shown in Table 1, and 30 s at 72 ̊C. The reference strains from each group-specific alkB gene were Rh. jialingiae, S. rhizophila, Ps. gessardii. Cycle thresholds were determined by comparison with standard curves constructed using several concentrations of a positive clone. The plasmid DNA concentration was determined on a Qubit 2.0 Fluorometer, and the copy number of the target gene was calculated directly from the concentration of the extracted plasmid DNA. Ten-fold serial dilutions of a known copy number of plasmid DNA were subjected to real-time PCR in five replicates to generate an external standard curve. Three replicates for each sample were used for qPCR analyzes. All of qPCR assays performed with efficiency of more than 94%, R2 values greater than 0.99. Table 1. Group-Specific alkB primers used in this study Tm (°C) Primers R1f438 R1r835 GPf519 GPr744 Stf556 Stf712
Sequence (5’-3’) CGTCGAGCGCTGGTTGTCC GACGTAGGAGTCCGTAGTGC CACCGTGATGTIGCTACACCG GGAACACCAGCATCTTIGG TGAGTGACGAACACGGCTAC TAATGGTTGACCAGGCAGGC
54
Phylogenetic affiliation Rhodococcus spp.
54
Pseudomonas spp.
60
Stenotrophomonas spp
References (Hamamura et al. 2008) (Hamamura et al. 2008) -
2.4 Statistical analysis Sampling and chemical analyses were carried out in triplicate and biological analyses in quintuplicate, and all results were expressed on an air-dried sample basis. Statistical analyses were performed using Origin 8.0 (OriginLab, Northampton, USA) and R Statistical Software (R 3.0.0, R Foundation for Statistical Computing Version, Vienna, Austria) packages. The confidence of data generated in the present investigations has been analyzed by standard statistical methods to determine the mean values and standard errors (SEs). The means were compared using Fisher’s least significant difference at α=0.05. The values in figures were expressed as mean ±SE of the corresponding replicates. 3. RESULTS AND DISCUSSION 3.1 Hydrocarbon content dynamics in the process of bioremediation Hydrocarbons are one of the main factors which determine the environmental hazard of oily wastes. Therefore, changes of hydrocarbon content are important to monitor waste remediation efficiency. TPH content dynamics in the oily waste remediated using 3 methods are presented in Fig. 1.
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Fig.1. TPH content dynamics in the process of bioremediation. As shown on Fig.1, TPH content did not differ significantly between samples I, II and III representing the 3 methods of bioremediation. At the beginning of the process, it was about 50 g kg-1, then it fluctuated up to day 63 and later remained stable. At the end of bioremediation, TPH content had decreased by about 1.8-1.9 times in all three samples. This decrease may be defined as an effective one as compared with other published data (Zhang et al. 2011; Wu et al. 2017). In terms of hydrocarbon content, bioaugmentation did not cause any additional effect on biostimulation. Most likely, indigenous waste microbes have the ability to degrade hydrocarbons, and the addition of compost intensifies this process due to several mechanisms: first, the concentration of hydrocarbon in the initial waste falls due to simple dilution; second, compost contains nutrients needed for hydrocarbon degraders, e.g. nitrogen; and third compost serves as a structural agent for oily waste, it improves the waste’s aeration. This is in line with other works where authors did not observe additional effects of bioaugmentation in their investigations (Li et al. 2009; Jiang et al. 2016; Wu et al. 2016; Kauppi et al. 2011). Fodelianakis with coauthors (2015) demonstrated that indigenous microorganisms, but not the introduced ones, played a more important role in the bioremediation of the oily waste. Liu et al. (2014) even found that bioaugmentation may decrease the positive effect of biostimulation. 3.2 Phytotoxicity dynamics in the process of bioremediation Besides hydrocarbon content dynamics, toxicity of oily waste is commonly used as an indicator of bioremediation efficiency (Morelli et al. 2005; Pelletier et al. 2004). In the literature, bioassays with aquatic organisms as well as with terrestrial higher plants are often used. In our investigation, we used a contact plant bioassay supposing that a contact test is more suitable for toxicity estimation of non-water soluble pollutants such as hydrocarbons as compared with elutriate one, such as a conventional bioassay with daphnids or infusoria (Selivanovskaya & Galitskaya 2011). With one and the same TPH content toxicity of the waste may be different, because TPH are a mixture of hydrocarbons of different sizes, structures and toxicity, therefore toxicity estimation may give additional information about bioremediation process (Reddy et al. 2011; Kriipsalu & Nammari 2010; Saterbak et al. 2000). Results of phytotoxicity estimation expressed in GI are presented in Fig. 2.
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Fig. 2. Phytotoxicity dynamics in the process of bioremediation As shown in the figure, the GI of oily waste remediated using method I without microbial inoculation increases from the beginning of remediation up to day 90, then decreases up to 120 day and then raises. Fluctuations of phytotoxicity may be explained by partial degradation of oil hydrocarbons with formation of toxic metabolites. Most likely, after day 90, these metabolites are appeared and later (after the 120 day) utilized by microbes and therefore oily waste becomes to be less toxic. Fluctuations of oily waste toxicity in the process of hydrocarbon biodegradation have been described by other authors previously (Morelli et al. 2001). On day 150 the GI exceeds 100% in the remediation mixture I, which means that the remediated oily waste has become not hazardous, but stimulating, for plants. Inoculation of the remediation mixture by hydrocarbon degrading strains led to the following results. First, desynchronization of phytotoxicity fluctuations with no significant changes of GI level was observed. Such a type of response in the microbial community changes was observed earlier and described in our previous works (Selivanovskaya et al. 2008). Second, at the end of bioremediation, the GI in the inoculated remediation mixtures differed slightly but in a statistically significant way from that in the non-inoculated mixture: it was higher in the remediation mixture I and lower in the remediation mixture III. This means that additional bioaugmentation affects bioremediation efficiency in terms of phytotoxicity, but the effect is not strong and has no dose-response effects. 3.3 Microbial counts dynamics in the process of bioremediation Microbes are the driving force of hydrocarbon biodegradation in the process of bioremediation (Galitskaya et al. 2016). Changes of TPH content and phytotoxicity described in the previous paragraphs happen because of microbial processes going on in the remediation mixtures. In our study, we estimated microbial community status using bacterial and fungal counts as well as specific hydrocarbon degradation encoding genes copy numbers. As shown in Fig. 3a, the maximal bacterial copy number was observed in the remediation mixture I between the 10thand 36th days, when it ranged between 1.5-4.0х109 per gram of mixture. Bacterial gene copy number is significantly higher in the non-inoculated remediation mixture compared with the inoculated ones during the first 63 days of experiment. That means that, first, inoculation did not lead to active growth of bacterial communities, which can be explained by comparatively low
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
number of bacterial cells in the inoculate (about 108) in comparison with total bacterial counts (109) and low survival rate of introduced bacteria. And second, that introduced strains inhibited the indigenous community in terms of bacterial counts. After 60 days, bacterial copy number remained stable and low in line with the TPH content described above. a
b
Fig. 3. Bacterial (a) and fungal (b) copy number dynamics in the process of bioremediation. Fungal gene copy number had similar dynamics: in the non-inoculated remediation mixture there were significantly more fungi than in the inoculated ones before day 63, and in all three mixtures low and stable counts of fungi were observed after day 63 (Fig. 3b). Most likely, this fact may be explained by competitive pressure that introduced bacterial strains exert on the indigenous bacterial and fungal ones. Colombo with co-authors (2011) demonstrated this phenomenon in oily polluted soil . Overall, fungal gene copy numbers were 103-fold lower than bacterial ones, which is in line with data presented in the literature (Wang et al. 2012; Lang et al. 2000). Thus, microbial counts became lower after bacterial inoculation and, at the same time,
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
bioremediation efficiency did not change. We suggest that this is due to enlarged amounts of hydrocarbon degraders in mixtures II and III which compensate for the total bacterial and fungal count fall. In order to check this hypothesis, we estimated in the remediation mixtures copy numbers of specific hydrocarbon degrading alkB-genes belonging to Rhodococcus, Pseudomonas and Stenotrophomonas taxa. Bacterial strains belonging to these taxa were present in the inoculation. a
b
c
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Fig.4. Copy number of the alkB genes in samples II and III (a- Rhodococcus spp.; b – Pseudomonas spp.; c – Stenotrophomonas spp.). As shown in the Fig. 4a-c, the gene copy numbers of all three alkB genes were stable during the process of bioremediation in mixture I. On the contrary, in inoculated mixtures II and III it changed significantly over time. For all three alkB genes, significant increase of gene copy numbers was observed on the day of inoculation. Interestingly, that after the first inoculation gene copy numbers first increased and then fell, and after the second and third inoculation – fell without any growth. This difference may be explained by higher stability of the community by day 28 when the second and third inoculations were made and consequently lower survival rate of the introduced bacteria. The data described above show that our hypothesis was right, and that introduction of populations of hydrocarbon degraders, on the one hand, inhibit indigenous microbes, and therefore, most likely, decrease the initial TPH biodegradation rate, but on the other hand, efficiently decompose hydrocarbons by themselves and compensate, through this, the TPH biodegradation rate. 4. CONCLUSION In this work, three methods of bioremediation of oily waste produced in a refinery (Mari El, Russia) were implemented. All three methods included biostimulation with compost and two methods additionally included bioaugmentation. All three methods had the same efficiency in terms of TPH level declination and comparative efficiency in terms of phytotoxicity. Two methods that included bacterial inoculation of remediated mixture led to a decrease of bacterial and fungal counts and a simultaneous increase of hydrocarbon degrading species populations. Most likely, these two processes compensated each other which resulted in no differences in bioremediation efficiency. From a practical point of view, biostimulation without bioaugmentation may be recommended as the simplest of the methods checked. ACKNOWLEDGEMENT The work is performed according to the Russian Government Program of Competitive Growth of Kazan Federal University. The research was performed using the equipment of
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Interdisciplinary Center for Shared Use of Kazan Federal University. REFERENCES Agamuthu, P., Tan, Y.S. & Fauziah, S.H., 2013. Bioremediation of Hydrocarbon Contaminated Soil Using Selected Organic Wastes. Procedia Environmental Sciences, 18, pp.694–702. Available at: http://linkinghub.elsevier.com/retrieve/pii/S1878029613002260. Agarwal, A. & Liu, Y., 2015. Remediation technologies for oil-contaminated sediments. Marine Pollution Bulletin, 101(2), pp.483–490. Alexander, M., 1999. Bioremediation and Biodegradation. Focus, 32, pp.1126–1133. 2012a. ISO 11269-1:2012 Soil quality -- Determination of the effects of pollutants on soil flora -Part 1: Method for the measurement of inhibition of root growth. , p.16. 2012b. ISO 11269-2:2012 Soil quality -- Determination of the effects of pollutants on soil flora -Part 2: Effects of contaminated soil on the emergence and early growth of higher plants. , p.19. Benyahia, F. & Embaby, A.S., 2016. Bioremediation of crude oil contaminated desert soil: Effect of biostimulation, bioaugmentation and bioavailability in biopile treatment systems. International Journal of Environmental Research and Public Health, 13(2). Cai, B. et al., 2016. Comparison of phytoremediation, bioaugmentation and natural attenuation for remediating saline soil contaminated by heavy crude oil. Biochemical Engineering Journal, 112, pp.170–177. Cappello, S. et al., 2007. Microbial community dynamics during assays of harbour oil spill bioremediation: A microscale simulation study. Journal of Applied Microbiology, 102(1), pp.184– 194. Cerqueira, V.S. et al., 2014. Comparison of bioremediation strategies for soil impacted with petrochemical oily sludge. International Biodeterioration and Biodegradation, 95(PB), pp.338– 345. Chen, M. et al., 2015. Bioremediation of soils contaminated with polycyclic aromatic hydrocarbons, petroleum, pesticides, chlorophenols and heavy metals by composting: Applications, microbes and future research needs. Biotechnology Advances, 33(6), pp.745–755. Colombo, M. et al., 2011. Bioremediation of polyaromatic hydrocarbon contaminated soils by native microflora and bioaugmentation with Sphingobium chlorophenolicum strain C3R: A feasibility study in solid- and slurry-phase microcosms. International Biodeterioration and Biodegradation, 65(1), pp.191–197. D’Annibale, A. et al., 2006. Role of autochthonous filamentous fungi in bioremediation of a soil historically contaminated with aromatic hydrocarbons. Applied and Environmental Microbiology, 72(1), pp.28–36. Dellagnezze, B.M. et al., 2016. Bioaugmentation strategy employing a microbial consortium immobilized in chitosan beads for oil degradation in mesocosm scale. Marine Pollution Bulletin, 107(1), pp.107–117. Fodelianakis, S. et al., 2015. Allochthonous bioaugmentation in ex situ treatment of crude oilpolluted sediments in the presence of an effective degrading indigenous microbiome. Journal of Hazardous Materials, 287, pp.78–86. Galitskaya, P. et al., 2015. Response of soil microorganisms to radioactive oil waste: results from a leaching experiment. Biogeosciences, 12, pp.3681–3693. Galitskaya, P., Akhmetzyanova, L. & Selivanovskaya, S., 2016. Biochar-carrying hydrocarbon decomposers promote degradation during the early stage of bioremediation. Biogeosciences, 13(20), pp.5739–5752.
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Gilbert, E.S. & Crowley, D.E., 1998. Repeated application of carvone-induced bacteria to enhance biodegradation of polychlorinated biphenyls in soil. Applied Microbiology and Biotechnology, 50(4), pp.489–494. Hamamura, N. et al., 2008. Assessing soil microbial populations responding to crude-oil amendment at different temperatures using phylogenetic, functional gene (alkB) and physiological analyses. Environmental Science and Technology, 42(20), pp.7580–7586. Hassanshahian, M. et al., 2016. Comparison the effects of bioaugmentation versus biostimulation on marine microbial community by PCR-DGGE: A mesocosm scale. Journal of Environmental Sciences (China), 43, pp.136–146. Heuer, H. et al., 1997. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. Applied and Environmental Microbiology, 63(8), pp.3233–3241. Jiang, Y. et al., 2016. Insights into the biodegradation of weathered hydrocarbons in contaminated soils by bioaugmentation and nutrient stimulation. Chemosphere, 161, pp.300– 307. Kauppi, S., Sinkkonen, A. & Romantschuk, M., 2011. Enhancing bioremediation of diesel-fuelcontaminated soil in a boreal climate: Comparison of biostimulation and bioaugmentation. International Biodeterioration and Biodegradation, 65(2), pp.359–368. Kriipsalu, M. & Nammari, D., 2010. Monitoring of biopile composting of oily sludge. Waste Management & Research, 28(5), pp.395–403. Available at: http://journals.sagepub.com/doi/10.1177/0734242X09337749. Lang, E., Kleeberg, I. & Zadrazil, F., 2000. Extractable organic carbon and counts of bacteria near the lignocellulose-soil interface during the interaction of soil microbiota and white rot fungi. Bioresource Technology, 75(1), pp.57–65. Li, X. et al., 2009. Biodegradation of the low concentration of polycyclic aromatic hydrocarbons in soil by microbial consortium during incubation. Journal of Hazardous Materials, 172(2–3), pp.601–605. Liu, P.W.G. et al., 2014. Bioaugmentation efficiency investigation on soil organic matters and microbial community shift of diesel-contaminated soils. International Biodeterioration and Biodegradation, 95(PA), pp.276–284. Macnaughton, S.J. et al., 1999. Microbial population changes during bioremediation of an experimental oil spill. Applied and Environmental Microbiology, 65(8), pp.3566–3574. Mao, J. et al., 2012. Bioremediation of polycyclic aromatic hydrocarbon-contaminated soil by a bacterial consortium and associated microbial community changes. International Biodeterioration and Biodegradation, 70, pp.141–147. Mishra, S. et al., 2001. In situ bioremediation potential of an oily sludge-degrading bacterial consortium. Current Microbiology, 43(5), pp.328–335. Morelli, I.S. et al., 2001. Effect of petrochemical sludge concentrations on changes in mutagenic activity during soil bioremediation process. Environmental Toxicology and Chemistry, 20(10), pp.2179–2183. Available at: http://dx.doi.org/10.1002/etc.5620201007. Morelli, I.S. et al., 2005. Laboratory study on the bioremediation of petrochemical sludgecontaminated soil. International Biodeterioration and Biodegradation, 55(4), pp.271–278. Newcombe, D.A. & Crowley, D.E., 1999. Bioremediation of atrazine-contaminated soil by repeated applications of atrazine-degrading bacteria. Applied Microbiology and Biotechnology, 51(6), pp.877–882. Nübel, U. et al., 1996. Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis. Journal of Bacteriology,
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
178(19), pp.5636–5643. Ouyang, W. et al., 2005. Comparison of bio-augmentation and composting for remediation of oily sludge: A field-scale study in China. Process Biochemistry, 40(12), pp.3763–3768. Available at: http://www.sciencedirect.com/science/article/pii/S1359511305002564 [Accessed June 10, 2017]. Pelletier, E., Delille, D. & Delille, B., 2004. Crude oil bioremediation in sub-Antarctic intertidal sediments: Chemistry and toxicity of oiled residues. Marine Environmental Research, 57(4), pp.311–327. Reddy, M.V. et al., 2011. Aerobic remediation of petroleum sludge through soil supplementation: Microbial community analysis. Journal of Hazardous Materials, 197, pp.80– 87. Sarma, P.M. et al., 2004. Degradation of polycyclic aromatic hydrocarbons by a newly discovered enteric bacterium, Leclercia adecarboxylata. Applied and Environmental Microbiology, 70(5), pp.3163–3166. Saterbak, A.N.N. et al., 2000. Ecotoxicological and analytical assessment of effects of bioremediation on hydrocarbon-containing soils. Environmental Toxicology and Chemistry, 19(11), pp.2643–2652. Sayara, T., Sarrà, M. & Sánchez, A., 2010. Effects of compost stability and contaminant concentration on the bioremediation of PAHs-contaminated soil through composting. Journal of Hazardous Materials, 179(1–3), pp.999–1006. Schwartz, E. & Scow, K.M., 2001. Repeated inoculation as a strategy for the remediation of low concentrations of phenanthrene in soil. Biodegradation, 12(3), pp.201–207. Selivanovskaya, S.Y. & Galitskaya, P.Y., 2011. Ecotoxicological assessment of soil using the Bacillus pumilus contact test. European Journal of Soil Biology, 47(2), pp.165–168. Selivanovskaya, S.Y., Kuritsin, I.N. & Schnel, S., 2008. Influence of non-traditional soil improvers on nitrogenase and respiratory activity of gray forest soil (in Russian). In coll. articles Fundamental achievements in soil science, ecology, agriculture on the way to innovation. Moscow, pp. 82–85. Simons, K.L. et al., 2013. Carrier mounted bacterial consortium facilitates oil remediation in the marine environment. Bioresource Technology, 134, pp.107–116. Taccari, M. et al., 2012. Effects of biostimulation and bioaugmentation on diesel removal and bacterial community. International Biodeterioration and Biodegradation, 66(1), pp.39–46. Thompson, I.P. et al., 2005. Bioaugmentation for bioremediation: The challenge of strain selection. Environmental Microbiology, 7(7), pp.909–915. Tyagi, M., da Fonseca, M.M.R. & de Carvalho, C.C.C.R., 2011. Bioaugmentation and biostimulation strategies to improve the effectiveness of bioremediation processes. Biodegradation, 22(2), pp.231–241. Uyttebroek, M. et al., 2007. Characterization of cultures enriched from acidic polycyclic aromatic hydrocarbon-contaminated soil for growth on pyrene at low pH. Applied and Environmental Microbiology, 73(10), pp.3159–3164. Wang, S. et al., 2012. Case study of the relationship between fungi and bacteria associated with high-molecular-weight polycyclic aromatic hydrocarbon degradation. Journal of Bioscience and Bioengineering, 113(5), pp.624–630. White, T.J. et al., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, pp.315–322. Wu, M. et al., 2016. Bioaugmentation and biostimulation of hydrocarbon degradation and the microbial community in a petroleum-contaminated soil. International Biodeterioration and
Sardinia 2017 / Sixteenth International Waste Management and Landfill Symposium / 2 - 6 October 2017
Biodegradation, 107, pp.158–164. Wu, M. et al., 2017. Bioremediation of hydrocarbon degradation in a petroleum-contaminated soil and microbial population and activity determination. Chemosphere, 169, pp.124–130. Zhang, Y. et al., 2011. Remediation of polycyclic aromatic hydrocarbon (PAH) contaminated soil through composting with fresh organic wastes. Environmental Science and Pollution Research, 18(9), pp.1574–1584. Zucconi, F. et al., 1981. Biological evaluation of compost maturity. BioCycle, 22(4), pp.27–29.
