DNA Isolation and PCR Purpose
Chloe Evetts (8990-4674) Cameron Jacobs (7908-1325)
DNA Isolation and PCR Purpose The purpose of this experiment is to learn how PCR and gel electrophoresis works, so that we can in the future use it in paternity tests, research, and diagnostic evaluations. PCR will amplify DNA sequences so they can be analyzed more clearly. This technique is often used in forensics. We will use it in the microbiology laboratory to identify our unknown organism.
Hypothesis By running our unknown through the PCR process, we should be able to identify it based on its individual DNA sequences and genome.
Procedure
1. DNA isolation Note: Inoculate 1 NA or TSB plate with a pure colony of your unknown organism
>24 h PRIOR to DNA isolation. Note: make sure you have a pure culture Note: Wear gloves at all times. Supplies and Reagents (DNA extraction) • 2 x 1.5 mL microcentrifuge tube per sample. •
Inoculating loop
•
Sterile 1X Sterile PBS buffer.
•
Microcentrifuge
•
Heating block
•
Chemglass beads
•
Vortex
Procedure 1. Label everything. 2. Take a micro-centrifuge tube with 1mL 1x Sterile PBS buffer. 3. Harvest one whole plate of cells (scrape off without getting agar pieces). Use ALL cells and colonies, scrape off the agar plate using a sterile inoculating loop and suspend them in the micro tube with 1mL 1X Sterile PBS buffer (without the glass beads).
4. Vortex at max speed for 5 sec. 5. Centrifuge at 10,000 x g for 1 min. Look for a cell pellet. The DNA is in the pellet inside the cells. 6. Discard supernatant (suck off with P1000, without touching the pellet) 7. Add 0.5 mL 1x sterile PBS buffer to the pellet 8. Resuspend the pellet by vortexing at max speed until the whole pellet is dissolved. 9. Place in hot water bath at 85°C for 5min. 10. Transfer the content to a new microcentrifuge tube containing 0.1 mL Chemglass beads. 11. Vortex for 5 min at highest speed. 12. Centrifuge for 1 min at 10,000 x g. Your DNA is now in the supernatant. Transfer supernatant to new tube. Discard the pellet.
You may stop at this point - listen to the instructions of your TAs. Detailed DNA Purification Protocol 1. Take 150uL of the DNA extraction supernatant. 2. Add 400μl of PowerClean™ DNA Solution 5 to the supernatant (be careful that solution doesn’t exceed rim of Collection Tube) and vortex for 5 seconds. PowerClean ™ DNA Solution 5 is a high salt concentration solution. Since DNA binds tightly to silica at high salt concentrations, this solution will adjust the salt concentrations to allow binding of DNA, but not non-DNA organic and inorganic material that may still be present at low levels, to the Spin Filters. 3. Load approximately 550μl onto a Spin Filter and centrifuge at 10,000 x g for 1 minute at room temperature. Discard the flow through and load the remaining supernatant onto the Spin Filter and centrifuge at 10,000 x g for 1 minute at room temperature. Note: A total of two loads for each sample processed may be required. DNA is selectively bound to the silica membrane in the Spin Filter device in the high salt solution. Contaminants pass through the filter membrane, leaving only the DNA bound to the membrane. 4. Add 500μl of PowerClean™ DNA Solution 6 and centrifuge at 10,000 x g for 30 seconds at room temperature. This solution is an ethanol based wash solution used to further clean the DNA that is bound to the silica filter membrane in the Spin Filter. This wash solution removes residues of salt and other contaminants while allowing the DNA to stay bound to the silica membrane.
5. Discard the flow through from the Collection Tube. The flow through fraction is non-DNA organic and inorganic waste removed from the silica spin filter membrane by the ethanol wash solution. 6. Centrifuge at 10,000 x g for 1 minute at room temperature. This second spin removes residual ethanol wash solution. It is critical to remove all traces of wash solution because the ethanol in PowerClean™ DNA Solution 6 can interfere with many downstream applications such as PCR, restriction digests and gel electrophoresis. 7. Carefully place the Spin Filter in a new Collection Tube (provided). Avoid splashing any PowerClean™ DNA Solution 6 onto the Spin Filter. Note: It is important to avoid any traces of the ethanol based wash solution. 8. Add 50μl of PowerClean™ DNA Solution 7 to the center of the white filter membrane. Note: Placing this Solution (sterile elution buffer) in the center of the small white membrane will make sure the entire membrane is wetted. This will result in a more efficient release of the DNA from the silica Spin Filter membrane. As PowerClean™ DNA Solution 7 (sterile elution buffer) passes through the silica membrane, DNA is released because it only stays bound to the silica Spin Filter membrane in the presence of high concentration of salt. PowerClean™ DNA Solution 7 is 10mM Tris pH 8 and does not contain EDTA. Alternatively, sterile DNA-Free PCR Grade Water (MO BIO Laboratories Catalog No. 17000-10) may be used for elution from the silica Spin Filter membrane at this step. 9. Centrifuge the Spin Filter at 10,000 x g for 30 seconds at room temperature. 10. Discard the Spin Filter. The DNA in the Collection Tube is now ready. No further steps are required. We recommend storing DNA frozen (-20° to -80°C). PowerClean™ DNA Solution 7 does not contain EDTA.
2. Quantify DNA Concentration BioTech Epoch Take 3 plate Procedure 1. Open Gen5 Program (BioTech program). 2. Under “Create New Item” menu, click “Take3”. 3. Double click on “Nucleic Acid” on the left side of the screen. 4. Select Sample Type “dsDNA” from drop down menu. 5. Make sure the Well Type is set to Microspot. 6. Open the Take3 plate lid to access the microspots. 7. Pipette 2 μL of the PBS Blank or H2O into the microspots. 8. Close the plate lid GENTLY.
9. Select the BLANK wells to be read. Click Read Blanks. The tray door will open and the carrier will eject. 10. Place plate into the microplate carrier. Align “A1” on the plate with position “A1” on the carrier. 11. Press OK. The Blanks will be read by the instrument. 12. The door will open, remove plate, open the plate lid, and wipe off the Blanks off the top and bottom slides with a Kim Wipe. 13. Pipette 2 μL of the Samples into any of the microwells. Make sure you remember the location of your sample. 14. Place plate into the microplate carrier. Align “A1” on the plate with the “A1” position on the carrier. 15. Select the SAMPLE wells to be read (should be the same wells as the ones chosen for the Blanks). Click Read Samples and then click OK. 16. When finished, Excel will launch and display the results (you may need to click End of Batch). 17. Record results. 18. Determine the A260 and A280 readings for each sample. Record this data and calculate the amount needed for your specific PCR reaction 3. 16s RNA PCR (Polymerase Chain Reaction) Supplies and Reagents • Sterile PCR Water •
GoTaq Hot Start Colorless Master Mix stored at -20°C
•
8F Primer (AGAGTTTGATCCTTGGCTCAG) at a concentration of 10 μM
•
1492R Primer (GCYTACCTTGTTACGACTT) at a concentration of 10 μM
•
0.2 mL microcentrifuge tube.
•
Micropipette
•
Eppendorf Mastercycler pro.
•
Micropipette
Procedure Note: Never label the 0.2mL microcentrifuge tubes on the cap. The heat of the PCR Thermo Cycler lid will erase your labeling. Label the side of the micro tube. And always prepare the reaction mix to a final volume of 25μL. 1. Label everything. 2. Transfer 5 μL of your DNA sample to a PCR microtubes that already contains the master mix 3. Put the PCR tube in the PCR machine – by row Ingredient
Concentration
Amount
DNA Water Master mix
5’ GATGAGTCTGCGTCTTATTAGCTAGTTGGTAGGGTAAATGCCTACCAAGGCAA TGATAAGTAACCGGCCTGAGAGGGTGAACGGTCACACTGGAACTGAGATAC GGTCCAGACTCCTACGGGAGGCAGCAGCTAAGAATCTTCCGCAATGGGCGA AAGCCTGACGGAGCGACACTGCGTGAATGAAGAAGGTCGAA-3’
BIOINFORMATIC analysis You may use any resources you like including the web but your work must be your own. 1.) Basic Local Alignment Search Tool 2.) NCBI Nucleotide Collection (nr/nt) Database 3.) Wikipedia Results As expected, we were able to isolate our unknowns DNA and due to proper aseptic technique combined with PCR, we were able to successfully amplify its 16s RNA and run it through gel electrophoresis to confirm our results, as pictured below. Our 260/280 was 1.9575 and concentration 66.1435. A pure sample of DNA (free of protein) has a 260/280 of 1.8.
Discussion/Conclusion PCR and DNA purification is a vital technique used in the microbiology lab and one that must be mastered in order to succeed when performing various experiments. In this lab, we successfully isolated the 16s RNA of our unknown organism, quantified the concentration via OD, and then amplified by Polymerase Chain reaction. The amplified 16s RNA was then run through gel electrophoresis against a 1kb DNA ladder, confirming that we had successfully amplified the 16s RNA. From there, the 16s RNA will be sequenced in order to determine our unknown organism. Glossary • 16s rRNA: a component of the 30S small subunit of prokaryotic ribosomes. It is 1.542kb (or 1542 nucleotides) in length. In addition to highly conserved primer binding sites, 16S rRNA gene sequences contain hypervariable regions that can provide species-specific signature sequences useful for bacterial identification.[12][13] As a result, 16S rRNA gene sequencing has become prevalent in medical microbiology as a rapid and cheap alternative to phenotypic methods of bacterial
•
identification. Agarose gel: easily cast and handled compared to other matrices, because the gel setting is a physical rather than chemical change. Samples are also easily recovered. After the experiment is finished, the resulting gel can be stored in a plastic bag in a refrigerator. Annealing: Used in the context of DNA renaturation after temperature dissociation of the two strands. Rate of annealing is a function of complementarity. Bioinformatics: an interdisciplinary field that develops and improves upon methods for storing, retrieving, organizing and analyzing biological data. DNA concentration determination: spectrophotometry
•
dNTP: the monomer, or single unit, of DNA, or deoxyribonucleic acid.
•
Eluate: The liquid or solution of solvent and dissolved material produced during elution or chromatography. Extension: The movement by which the two elements of any jointed part are drawn away from each other. Gel electrophoresis: a method for separation and analysis of macromolecules (DNA, RNA and proteins) and their fragments, based on their size and charge. Kary Mullis: Kary Banks Mullis is a Nobel Prize-winning American biochemist, author, and lecturer. In recognition of his improvement of the polymerase chain reaction technique, he shared the 1993 Nobel Prize PCR: a biochemical technology in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. Primer: a strand of nucleic acid that serves as a starting point for DNA synthesis. It is required for DNA replication because the enzymes that catalyze this process, DNA polymerases, can only add new nucleotides to an existing strand of DNA. Sanger sequencing: a method of DNA sequencing based on the selective incorporation of chain-terminating dideoxynucleotides by DNA polymerase during in vitro DNA replication Taq polymerase: a thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965. It is often abbreviated to "Taq Pol" (or simply "Taq"), and is frequently used in polymerase chain reaction (PCR), a method for greatly amplifying short segments of DNA. Thermus aquaticus: Thermus aquaticus is a species of bacterium that can tolerate high temperatures, one of several thermophilic bacteria that belong to the Deinococcus-Thermus group
•
•
•
• •
•
•
•
•
•
•
DNA Isolation and PCR Purpose The purpose of this experiment is to learn how PCR and gel electrophoresis works, so that we can in the future use it in paternity tests, research, and diagnostic evaluations. PCR will amplify DNA sequences so they can be analyzed more clearly. This technique is often used in forensics. We will use it in the microbiology laboratory to identify our unknown organism.
Hypothesis By running our unknown through the PCR process, we should be able to identify it based on its individual DNA sequences and genome.
Procedure
1. DNA isolation Note: Inoculate 1 NA or TSB plate with a pure colony of your unknown organism
>24 h PRIOR to DNA isolation. Note: make sure you have a pure culture Note: Wear gloves at all times. Supplies and Reagents (DNA extraction) • 2 x 1.5 mL microcentrifuge tube per sample. •
Inoculating loop
•
Sterile 1X Sterile PBS buffer.
•
Microcentrifuge
•
Heating block
•
Chemglass beads
•
Vortex
Procedure 1. Label everything. 2. Take a micro-centrifuge tube with 1mL 1x Sterile PBS buffer. 3. Harvest one whole plate of cells (scrape off without getting agar pieces). Use ALL cells and colonies, scrape off the agar plate using a sterile inoculating loop and suspend them in the micro tube with 1mL 1X Sterile PBS buffer (without the glass beads).
4. Vortex at max speed for 5 sec. 5. Centrifuge at 10,000 x g for 1 min. Look for a cell pellet. The DNA is in the pellet inside the cells. 6. Discard supernatant (suck off with P1000, without touching the pellet) 7. Add 0.5 mL 1x sterile PBS buffer to the pellet 8. Resuspend the pellet by vortexing at max speed until the whole pellet is dissolved. 9. Place in hot water bath at 85°C for 5min. 10. Transfer the content to a new microcentrifuge tube containing 0.1 mL Chemglass beads. 11. Vortex for 5 min at highest speed. 12. Centrifuge for 1 min at 10,000 x g. Your DNA is now in the supernatant. Transfer supernatant to new tube. Discard the pellet.
You may stop at this point - listen to the instructions of your TAs. Detailed DNA Purification Protocol 1. Take 150uL of the DNA extraction supernatant. 2. Add 400μl of PowerClean™ DNA Solution 5 to the supernatant (be careful that solution doesn’t exceed rim of Collection Tube) and vortex for 5 seconds. PowerClean ™ DNA Solution 5 is a high salt concentration solution. Since DNA binds tightly to silica at high salt concentrations, this solution will adjust the salt concentrations to allow binding of DNA, but not non-DNA organic and inorganic material that may still be present at low levels, to the Spin Filters. 3. Load approximately 550μl onto a Spin Filter and centrifuge at 10,000 x g for 1 minute at room temperature. Discard the flow through and load the remaining supernatant onto the Spin Filter and centrifuge at 10,000 x g for 1 minute at room temperature. Note: A total of two loads for each sample processed may be required. DNA is selectively bound to the silica membrane in the Spin Filter device in the high salt solution. Contaminants pass through the filter membrane, leaving only the DNA bound to the membrane. 4. Add 500μl of PowerClean™ DNA Solution 6 and centrifuge at 10,000 x g for 30 seconds at room temperature. This solution is an ethanol based wash solution used to further clean the DNA that is bound to the silica filter membrane in the Spin Filter. This wash solution removes residues of salt and other contaminants while allowing the DNA to stay bound to the silica membrane.
5. Discard the flow through from the Collection Tube. The flow through fraction is non-DNA organic and inorganic waste removed from the silica spin filter membrane by the ethanol wash solution. 6. Centrifuge at 10,000 x g for 1 minute at room temperature. This second spin removes residual ethanol wash solution. It is critical to remove all traces of wash solution because the ethanol in PowerClean™ DNA Solution 6 can interfere with many downstream applications such as PCR, restriction digests and gel electrophoresis. 7. Carefully place the Spin Filter in a new Collection Tube (provided). Avoid splashing any PowerClean™ DNA Solution 6 onto the Spin Filter. Note: It is important to avoid any traces of the ethanol based wash solution. 8. Add 50μl of PowerClean™ DNA Solution 7 to the center of the white filter membrane. Note: Placing this Solution (sterile elution buffer) in the center of the small white membrane will make sure the entire membrane is wetted. This will result in a more efficient release of the DNA from the silica Spin Filter membrane. As PowerClean™ DNA Solution 7 (sterile elution buffer) passes through the silica membrane, DNA is released because it only stays bound to the silica Spin Filter membrane in the presence of high concentration of salt. PowerClean™ DNA Solution 7 is 10mM Tris pH 8 and does not contain EDTA. Alternatively, sterile DNA-Free PCR Grade Water (MO BIO Laboratories Catalog No. 17000-10) may be used for elution from the silica Spin Filter membrane at this step. 9. Centrifuge the Spin Filter at 10,000 x g for 30 seconds at room temperature. 10. Discard the Spin Filter. The DNA in the Collection Tube is now ready. No further steps are required. We recommend storing DNA frozen (-20° to -80°C). PowerClean™ DNA Solution 7 does not contain EDTA.
2. Quantify DNA Concentration BioTech Epoch Take 3 plate Procedure 1. Open Gen5 Program (BioTech program). 2. Under “Create New Item” menu, click “Take3”. 3. Double click on “Nucleic Acid” on the left side of the screen. 4. Select Sample Type “dsDNA” from drop down menu. 5. Make sure the Well Type is set to Microspot. 6. Open the Take3 plate lid to access the microspots. 7. Pipette 2 μL of the PBS Blank or H2O into the microspots. 8. Close the plate lid GENTLY.
9. Select the BLANK wells to be read. Click Read Blanks. The tray door will open and the carrier will eject. 10. Place plate into the microplate carrier. Align “A1” on the plate with position “A1” on the carrier. 11. Press OK. The Blanks will be read by the instrument. 12. The door will open, remove plate, open the plate lid, and wipe off the Blanks off the top and bottom slides with a Kim Wipe. 13. Pipette 2 μL of the Samples into any of the microwells. Make sure you remember the location of your sample. 14. Place plate into the microplate carrier. Align “A1” on the plate with the “A1” position on the carrier. 15. Select the SAMPLE wells to be read (should be the same wells as the ones chosen for the Blanks). Click Read Samples and then click OK. 16. When finished, Excel will launch and display the results (you may need to click End of Batch). 17. Record results. 18. Determine the A260 and A280 readings for each sample. Record this data and calculate the amount needed for your specific PCR reaction 3. 16s RNA PCR (Polymerase Chain Reaction) Supplies and Reagents • Sterile PCR Water •
GoTaq Hot Start Colorless Master Mix stored at -20°C
•
8F Primer (AGAGTTTGATCCTTGGCTCAG) at a concentration of 10 μM
•
1492R Primer (GCYTACCTTGTTACGACTT) at a concentration of 10 μM
•
0.2 mL microcentrifuge tube.
•
Micropipette
•
Eppendorf Mastercycler pro.
•
Micropipette
Procedure Note: Never label the 0.2mL microcentrifuge tubes on the cap. The heat of the PCR Thermo Cycler lid will erase your labeling. Label the side of the micro tube. And always prepare the reaction mix to a final volume of 25μL. 1. Label everything. 2. Transfer 5 μL of your DNA sample to a PCR microtubes that already contains the master mix 3. Put the PCR tube in the PCR machine – by row Ingredient
Concentration
Amount
DNA Water Master mix
5’ GATGAGTCTGCGTCTTATTAGCTAGTTGGTAGGGTAAATGCCTACCAAGGCAA TGATAAGTAACCGGCCTGAGAGGGTGAACGGTCACACTGGAACTGAGATAC GGTCCAGACTCCTACGGGAGGCAGCAGCTAAGAATCTTCCGCAATGGGCGA AAGCCTGACGGAGCGACACTGCGTGAATGAAGAAGGTCGAA-3’
BIOINFORMATIC analysis You may use any resources you like including the web but your work must be your own. 1.) Basic Local Alignment Search Tool 2.) NCBI Nucleotide Collection (nr/nt) Database 3.) Wikipedia Results As expected, we were able to isolate our unknowns DNA and due to proper aseptic technique combined with PCR, we were able to successfully amplify its 16s RNA and run it through gel electrophoresis to confirm our results, as pictured below. Our 260/280 was 1.9575 and concentration 66.1435. A pure sample of DNA (free of protein) has a 260/280 of 1.8.
Discussion/Conclusion PCR and DNA purification is a vital technique used in the microbiology lab and one that must be mastered in order to succeed when performing various experiments. In this lab, we successfully isolated the 16s RNA of our unknown organism, quantified the concentration via OD, and then amplified by Polymerase Chain reaction. The amplified 16s RNA was then run through gel electrophoresis against a 1kb DNA ladder, confirming that we had successfully amplified the 16s RNA. From there, the 16s RNA will be sequenced in order to determine our unknown organism. Glossary • 16s rRNA: a component of the 30S small subunit of prokaryotic ribosomes. It is 1.542kb (or 1542 nucleotides) in length. In addition to highly conserved primer binding sites, 16S rRNA gene sequences contain hypervariable regions that can provide species-specific signature sequences useful for bacterial identification.[12][13] As a result, 16S rRNA gene sequencing has become prevalent in medical microbiology as a rapid and cheap alternative to phenotypic methods of bacterial
•
identification. Agarose gel: easily cast and handled compared to other matrices, because the gel setting is a physical rather than chemical change. Samples are also easily recovered. After the experiment is finished, the resulting gel can be stored in a plastic bag in a refrigerator. Annealing: Used in the context of DNA renaturation after temperature dissociation of the two strands. Rate of annealing is a function of complementarity. Bioinformatics: an interdisciplinary field that develops and improves upon methods for storing, retrieving, organizing and analyzing biological data. DNA concentration determination: spectrophotometry
•
dNTP: the monomer, or single unit, of DNA, or deoxyribonucleic acid.
•
Eluate: The liquid or solution of solvent and dissolved material produced during elution or chromatography. Extension: The movement by which the two elements of any jointed part are drawn away from each other. Gel electrophoresis: a method for separation and analysis of macromolecules (DNA, RNA and proteins) and their fragments, based on their size and charge. Kary Mullis: Kary Banks Mullis is a Nobel Prize-winning American biochemist, author, and lecturer. In recognition of his improvement of the polymerase chain reaction technique, he shared the 1993 Nobel Prize PCR: a biochemical technology in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. Primer: a strand of nucleic acid that serves as a starting point for DNA synthesis. It is required for DNA replication because the enzymes that catalyze this process, DNA polymerases, can only add new nucleotides to an existing strand of DNA. Sanger sequencing: a method of DNA sequencing based on the selective incorporation of chain-terminating dideoxynucleotides by DNA polymerase during in vitro DNA replication Taq polymerase: a thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965. It is often abbreviated to "Taq Pol" (or simply "Taq"), and is frequently used in polymerase chain reaction (PCR), a method for greatly amplifying short segments of DNA. Thermus aquaticus: Thermus aquaticus is a species of bacterium that can tolerate high temperatures, one of several thermophilic bacteria that belong to the Deinococcus-Thermus group
•
•
•
• •
•
•
•
•
•
•
