Enhancement of Cetuximab-Induced
Enhancement of Cetuximab-Induced Radiosensitization by JAK-1 Inhibition: Correlation with Inhibition on DNA Repair James A. Bonner, Hoa Q. Trummell, Christopher D. Willey, Markus Bredel, Eddy S. Yang Department of Radiation Oncology, University of Alabama at Birmingham, Birmingham, Alabama USA
SUMMARY The inhibition of Epidermal Growth Factor Receptor (EGFr) has previously been shown to result in radiosensitization [1]. The studies in this report suggested that dual inhibition of EGFr (cetuximab) and JAKSTAT-3 (JAK1i – supplied by Calbiochem, LaJolla, CA) leads to greater radiosensitization than with either cetuximab or JAK1i alone and this combination treatment may be clinically relevant even for tumors with a marked range of STAT-3 activity.
STAT-3 Knockdown Construction
EcoRI CCTAGG CTTAAG
Antisense Strand TTGAAGTCTGGGCAGTTGTTTAA
Loop NruI
BamHI
Sense Strand
CAGCGCTC TTAAACAACTGCCCAGACTTCAA
XhoI
GCCTAGG TGGAGCT
STAT3
U6 Promote r
Figure 3. The use of JAK1i (1µM) increased the radiosensitizing effects of cetuximab (0.5 µg/ml) in all four cell lines when cell proliferation was assessed. The data represent the mean and standard error of three assessments. Cell proliferation was assessed 72h
GAPDH
after indicated treatments and normalized to vehicle-treated cells (100%). The overall significance of the comparisons between cetuximab, JAK1i and RT vs. either cetuximab and RT [p=0.0001] or JAK1i and RT [p=0.0001] were pronounced. Cell proliferation was assessed with daily cell counts as previously described [2,3].
XhoI
MCS
U6
120
AmpR SV40 Promoter
pBABE-U6
Puro
STAT3 (% of UM-SCC-5)
BamHI
100 80 60 40 20
Figure 6. Representative colony formation assay demonstrated radiosensitization with Cetuximab (0.25 µg/ml x 18 h prior to RT), JAK1i (1 µM x 18 h prior to RT) or both agents 18 h prior to RT. Colony formation was assessed as previously described [1-3].
0
UM-SCC-5
STAT3-2.4
STAT3-2.9
NEG4.17
Table 1. Sequence for STAT3 shRNA with the negative control shRNA strand containing the two nucleotide basepair mismatch shown in bold. shRNA
Sense Sequence (5’3’)
STAT3
ACTTCAGACCCGTCAACAAA
NegativeSTAT3
ACTTCAGACACGGCAACAAA
Genes with 100% homology STAT3v1, v2, v3 none
Conclusions
Figure 4. The radiosensitizing effects of JAK1i and cetuximab correlated with increased apoptosis.
1.
JAK1i inhibits activated STAT-3 in human head and neck cancer cell lines with variable levels of STAT-3 and it causes radiosensitization.
2.
JAK1i enhances the known radiosensitizing properties of cetuximab suggesting that the addition of inhibitors of EGFr-activated proteins may be an efficacious method of enhancing cetuximab-induced radiosensitization.
3.
Cetuximab slows the repair of radiation-induced DNA dsbs and the addition of JAK1i increases this effect.
4.
The use of JAK-STAT-3 inhibitors combined with EGFr inhibitors and radiation may be a clinical useful means of improving the results of radiation treatment for head and neck cancer.
Apoptosis was assessed in exponentially growing cells that were collected after 72h treatments and analyzed using Annexin V-FITC kit. The overall significance of the comparisons between cetuximab, JAK1i and RT vs. either cetuximab and RT [p=0.0001] or JAK1i and RT [p=0.0001] were pronounced. Apoptosis was assessed by annexin V-FITC as previously described [2,3].
[2]. STAT-3 short hairpin RNA (shRNA) was cloned into a pBABE-U6 vector. The STAT-3 shRNA oligonucleotides were synthesized to have 100% homolgy to STAT v1, v2, v3. A negative control was synthesized with 2 mutated base pairs. The inserts were ligated as noted above and amplified in DH5-alpha cells. Plasmid DNA was used for transfection. The immunoblot insert shown stable knockdown of STAT-3 in the 2.4 clone (STAT-3-2.4 cells).
Figure 1. The STAT-3-2.4 knockdown and control NEG 4.17 cells were created as previously described
REFERENCES
Figure 2. Immunoblot analyses revealed that the phosphophorylation of STAT-3 was significantly reduced with the dual treatment of cetuximab and JAK1i as compared to either individual agent alone. Four head and neck squamous cell carcinoma cell lines were used. UM-SCC-1, UM-SCC-5, STAT-3 knockdown cells (STAT3-2.4) and control transfected cells (NEG4.17) were treated with cetuximab (5µg/ml) and/or JAK1i (1µM) for either 8 or 24h with or without 5 minutes of exposure to EGF (60ng/ml) as indicated in the figure. Protein lysates were subjected to SDS-PAGE and Western blot analysis for STAT-3, pSTAT-3(Tyr705) and pSTAT-3(Ser727). GAPDH was used to control for loading variability. Representative immunoblots for the UM-SCC-1 cells with (B) or without (A) EGF
Figure 5. The addition of JAK1i (1µM) to the combination of cetuximab (0.5 µg/ml) and radiation resulted in less repair of radiation-induced DNA double strand breaks (dsbs) at 6 and 24 hours following radiation, as measured by the neutral comet assay in all four cell lines. Top. The mean tail moment for 6 hours of treatments alone or proceeded by radiation. Bottom. The mean tail moment for 24 hours. Following treatment, exponentially growing cells were collected and processed for single-cell gel electrophoresis assay (Trevigen’s Comet Assay). Neutral comet assays were performed as previously described [3].
1. Bonner JA, Raisch KP, Trummell HQ, Robert F, Meredith RF, Spencer SA, Buchsbaum DJ, Saleh MN, Stackhouse MA, LoBuglio AF, Peters GE, Carroll WR, Waksal HW. Enhanced Apoptosis with Combination C225/Radiation Treatment Serves as the Impetus for Clinical Investigation in Head and Neck Cancers. J Clin Oncol, 18(21 Suppl):47S-53S, 2000. 2. Bonner JA, Trummell HQ, Willey CD, et al. Inhibition of STAT-3 Results in Radiosensitization of Human Squamous Cell Carcinoma. Radiother Oncol; 92:339-344, 2009. 3. Bonner JA, Yang ES, Trummell HQ, Nowsheen S, Willey CD, Raisch KP. Inhibition of STAT-3 results in greater cetuximab sensitivity in head and neck squamous cell carcinoma. Radiotherapy and Oncology, 99:339-343, 2011.
SUMMARY The inhibition of Epidermal Growth Factor Receptor (EGFr) has previously been shown to result in radiosensitization [1]. The studies in this report suggested that dual inhibition of EGFr (cetuximab) and JAKSTAT-3 (JAK1i – supplied by Calbiochem, LaJolla, CA) leads to greater radiosensitization than with either cetuximab or JAK1i alone and this combination treatment may be clinically relevant even for tumors with a marked range of STAT-3 activity.
STAT-3 Knockdown Construction
EcoRI CCTAGG CTTAAG
Antisense Strand TTGAAGTCTGGGCAGTTGTTTAA
Loop NruI
BamHI
Sense Strand
CAGCGCTC TTAAACAACTGCCCAGACTTCAA
XhoI
GCCTAGG TGGAGCT
STAT3
U6 Promote r
Figure 3. The use of JAK1i (1µM) increased the radiosensitizing effects of cetuximab (0.5 µg/ml) in all four cell lines when cell proliferation was assessed. The data represent the mean and standard error of three assessments. Cell proliferation was assessed 72h
GAPDH
after indicated treatments and normalized to vehicle-treated cells (100%). The overall significance of the comparisons between cetuximab, JAK1i and RT vs. either cetuximab and RT [p=0.0001] or JAK1i and RT [p=0.0001] were pronounced. Cell proliferation was assessed with daily cell counts as previously described [2,3].
XhoI
MCS
U6
120
AmpR SV40 Promoter
pBABE-U6
Puro
STAT3 (% of UM-SCC-5)
BamHI
100 80 60 40 20
Figure 6. Representative colony formation assay demonstrated radiosensitization with Cetuximab (0.25 µg/ml x 18 h prior to RT), JAK1i (1 µM x 18 h prior to RT) or both agents 18 h prior to RT. Colony formation was assessed as previously described [1-3].
0
UM-SCC-5
STAT3-2.4
STAT3-2.9
NEG4.17
Table 1. Sequence for STAT3 shRNA with the negative control shRNA strand containing the two nucleotide basepair mismatch shown in bold. shRNA
Sense Sequence (5’3’)
STAT3
ACTTCAGACCCGTCAACAAA
NegativeSTAT3
ACTTCAGACACGGCAACAAA
Genes with 100% homology STAT3v1, v2, v3 none
Conclusions
Figure 4. The radiosensitizing effects of JAK1i and cetuximab correlated with increased apoptosis.
1.
JAK1i inhibits activated STAT-3 in human head and neck cancer cell lines with variable levels of STAT-3 and it causes radiosensitization.
2.
JAK1i enhances the known radiosensitizing properties of cetuximab suggesting that the addition of inhibitors of EGFr-activated proteins may be an efficacious method of enhancing cetuximab-induced radiosensitization.
3.
Cetuximab slows the repair of radiation-induced DNA dsbs and the addition of JAK1i increases this effect.
4.
The use of JAK-STAT-3 inhibitors combined with EGFr inhibitors and radiation may be a clinical useful means of improving the results of radiation treatment for head and neck cancer.
Apoptosis was assessed in exponentially growing cells that were collected after 72h treatments and analyzed using Annexin V-FITC kit. The overall significance of the comparisons between cetuximab, JAK1i and RT vs. either cetuximab and RT [p=0.0001] or JAK1i and RT [p=0.0001] were pronounced. Apoptosis was assessed by annexin V-FITC as previously described [2,3].
[2]. STAT-3 short hairpin RNA (shRNA) was cloned into a pBABE-U6 vector. The STAT-3 shRNA oligonucleotides were synthesized to have 100% homolgy to STAT v1, v2, v3. A negative control was synthesized with 2 mutated base pairs. The inserts were ligated as noted above and amplified in DH5-alpha cells. Plasmid DNA was used for transfection. The immunoblot insert shown stable knockdown of STAT-3 in the 2.4 clone (STAT-3-2.4 cells).
Figure 1. The STAT-3-2.4 knockdown and control NEG 4.17 cells were created as previously described
REFERENCES
Figure 2. Immunoblot analyses revealed that the phosphophorylation of STAT-3 was significantly reduced with the dual treatment of cetuximab and JAK1i as compared to either individual agent alone. Four head and neck squamous cell carcinoma cell lines were used. UM-SCC-1, UM-SCC-5, STAT-3 knockdown cells (STAT3-2.4) and control transfected cells (NEG4.17) were treated with cetuximab (5µg/ml) and/or JAK1i (1µM) for either 8 or 24h with or without 5 minutes of exposure to EGF (60ng/ml) as indicated in the figure. Protein lysates were subjected to SDS-PAGE and Western blot analysis for STAT-3, pSTAT-3(Tyr705) and pSTAT-3(Ser727). GAPDH was used to control for loading variability. Representative immunoblots for the UM-SCC-1 cells with (B) or without (A) EGF
Figure 5. The addition of JAK1i (1µM) to the combination of cetuximab (0.5 µg/ml) and radiation resulted in less repair of radiation-induced DNA double strand breaks (dsbs) at 6 and 24 hours following radiation, as measured by the neutral comet assay in all four cell lines. Top. The mean tail moment for 6 hours of treatments alone or proceeded by radiation. Bottom. The mean tail moment for 24 hours. Following treatment, exponentially growing cells were collected and processed for single-cell gel electrophoresis assay (Trevigen’s Comet Assay). Neutral comet assays were performed as previously described [3].
1. Bonner JA, Raisch KP, Trummell HQ, Robert F, Meredith RF, Spencer SA, Buchsbaum DJ, Saleh MN, Stackhouse MA, LoBuglio AF, Peters GE, Carroll WR, Waksal HW. Enhanced Apoptosis with Combination C225/Radiation Treatment Serves as the Impetus for Clinical Investigation in Head and Neck Cancers. J Clin Oncol, 18(21 Suppl):47S-53S, 2000. 2. Bonner JA, Trummell HQ, Willey CD, et al. Inhibition of STAT-3 Results in Radiosensitization of Human Squamous Cell Carcinoma. Radiother Oncol; 92:339-344, 2009. 3. Bonner JA, Yang ES, Trummell HQ, Nowsheen S, Willey CD, Raisch KP. Inhibition of STAT-3 results in greater cetuximab sensitivity in head and neck squamous cell carcinoma. Radiotherapy and Oncology, 99:339-343, 2011.
