Next Generation Sequencing Personalized Sequencing
High Sensitivity Multiplex Short Tandem Repeat Loci Analyses with Massively Parallel Sequencing
TA Xiangpei Zeng, Jonathan L. King, Monika Stoljarova, David H. Warshauer, Bobby L. LaRue, Antti Sajantila, Jaynish Patel, Douglas R. Storts, Bruce Budowle
Next Generation Sequencing • A better name
• Massively Parallel Sequencing (MPS)
This image cannot currently be display ed.
Personalized Sequencing Genome Center Capabilities in the Forensic Laboratory
This image cannot currently be display ed.
1
MPS and “Gold Standard” Sanger Sequencing • Difference in scale: hundreds of billions of bases vs. hundreds • Each sequence is the product of a single molecule (individually or clonally interrogated) • For sensitivity of detection will need an initial amplification by PCR • Same as current marker typing • Challenge – multiplexing • Same requirements as current STR multiplexes This image cannot currently be display ed.
MPS Features • Massively parallel sequencing • Higher throughput • Fast • Lower cost per nucleotide • Marker multiplexing • Sample multiplexing This image cannot currently be display ed.
Size Matters??? • With CE the marker amplicons tagged with the same fluor had to be different sizes and/or use of mobility modifiers • Limits the number of loci that can be placed in a CE-based multiplex
• With MPS • Size [for detection purposes] is no longer an issue
This image cannot currently be display ed.
• Each molecule is read independently • Enables more markers to be analyzed simultaneously • Enables size of amplicons to be similar
2
MPS and STRs • Capillary electrophoresis exploits size differences • MPS exploits sequence Targeted MPS ~13-27 markers
100s of Markers
GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG
• Fragments can overlap in size • Read counts / noise Increasing size (bp) This image cannot currently be display ed.
Length Variations
Length and Sequence Variation
STRs • Current mainstay for identity testing • High discrimination power AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG
This image cannot currently be display ed.
STR Motifs Simple:
Compound:
Complex: TA This image cannot currently be display ed.
3
Prototype NGS STR Multiplex System • 17 STRs • CODIS 13 core loci • Penta D, Penta E loci • D2S1338, D19S433 loci
• Amelogenin locus • Amplicon lengths range is 176 – 332 bp
This image cannot currently be display ed.
Amplicon Sizes
This image cannot currently be display ed.
Locus Penta E D18S51 D21S11 TH01 D3S1358 FGA TPOX D8S1179 vWA Penta D CSF1PO D16S539 D7S820 D13S317 D5S818 D2S1338 D19S443
Smallest Known Allele 179 190 203 220 192 176 196 203 202 192 185 198 211 209 191 197 193
Largest Known Allele 284 277 273 264 240 332 244 255 262 265 229 246 255 257 239 269 253
PCR Conditions • 1 min at 96°C for polymerase activation • 30 cycles • 10 s at 94°C for denaturation • 1 min at 59°C for primer annealing • 30 s at 72°C for primer extension
• 10 min at 60°C for final extension • Total time
TA Xiangpei Zeng, Jonathan L. King, Monika Stoljarova, David H. Warshauer, Bobby L. LaRue, Antti Sajantila, Jaynish Patel, Douglas R. Storts, Bruce Budowle
Next Generation Sequencing • A better name
• Massively Parallel Sequencing (MPS)
This image cannot currently be display ed.
Personalized Sequencing Genome Center Capabilities in the Forensic Laboratory
This image cannot currently be display ed.
1
MPS and “Gold Standard” Sanger Sequencing • Difference in scale: hundreds of billions of bases vs. hundreds • Each sequence is the product of a single molecule (individually or clonally interrogated) • For sensitivity of detection will need an initial amplification by PCR • Same as current marker typing • Challenge – multiplexing • Same requirements as current STR multiplexes This image cannot currently be display ed.
MPS Features • Massively parallel sequencing • Higher throughput • Fast • Lower cost per nucleotide • Marker multiplexing • Sample multiplexing This image cannot currently be display ed.
Size Matters??? • With CE the marker amplicons tagged with the same fluor had to be different sizes and/or use of mobility modifiers • Limits the number of loci that can be placed in a CE-based multiplex
• With MPS • Size [for detection purposes] is no longer an issue
This image cannot currently be display ed.
• Each molecule is read independently • Enables more markers to be analyzed simultaneously • Enables size of amplicons to be similar
2
MPS and STRs • Capillary electrophoresis exploits size differences • MPS exploits sequence Targeted MPS ~13-27 markers
100s of Markers
GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG GTGTGATGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTGTGTG
• Fragments can overlap in size • Read counts / noise Increasing size (bp) This image cannot currently be display ed.
Length Variations
Length and Sequence Variation
STRs • Current mainstay for identity testing • High discrimination power AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG AATG
This image cannot currently be display ed.
STR Motifs Simple:
Compound:
Complex: TA This image cannot currently be display ed.
3
Prototype NGS STR Multiplex System • 17 STRs • CODIS 13 core loci • Penta D, Penta E loci • D2S1338, D19S433 loci
• Amelogenin locus • Amplicon lengths range is 176 – 332 bp
This image cannot currently be display ed.
Amplicon Sizes
This image cannot currently be display ed.
Locus Penta E D18S51 D21S11 TH01 D3S1358 FGA TPOX D8S1179 vWA Penta D CSF1PO D16S539 D7S820 D13S317 D5S818 D2S1338 D19S443
Smallest Known Allele 179 190 203 220 192 176 196 203 202 192 185 198 211 209 191 197 193
Largest Known Allele 284 277 273 264 240 332 244 255 262 265 229 246 255 257 239 269 253
PCR Conditions • 1 min at 96°C for polymerase activation • 30 cycles • 10 s at 94°C for denaturation • 1 min at 59°C for primer annealing • 30 s at 72°C for primer extension
• 10 min at 60°C for final extension • Total time
