supplementary material
SUPPLEMENTARY MATERIAL Effect of Polysaccharides Extracted from Sipunculus nudus (SNP) on the Lifespan and Immune Damage Repair of Drosophila melanogaster Exposed to Cd (VI) Jie Sua,b, Linlin Jiangb, Jingna Wub, Zhiyu Liub,*,1 and Yuping Wua,*,1
a
South China Sea Bio-Resource Exploitation and Utilization Collaborative Innovation Center, School
of Life Sciences, Guangdong Provincial Key Laboratoryof Marine Resources and Coastal Engineering, Zhuhai Key Laboratory of Marine Bioresources and Environment, School of Marine Sciences, Sun Yat-SenUniversity, Guangzhou 519000, PR China
b
Key Laboratory of Cultivation and High-value Utilization of Marine Organisms in Fujian Province,
Fujian Collaborative Innovation Center for Exploitationand Utilization of Marine Biological Resources, Fisheries Research Institute of Fujian, Xiamen, Fujian 361012, PR China
Abstract：The water-soluble polysaccharides extracted from Sipunculus nudus(SNP) was investigated on the lifespan and immune damage repair of Drosophila melanogaster exposed to Cd (VI). SNP increased Superoxyde dismutase (SOD), Nitrogen monoxide (NO), Glutathione peroxidase (GSH-Px), and total anti-oxidation competence(T-AOC), with decreased malondialdehyde (MDA) on Drosophila melanogaster demonstrated that SNP could attenuated oxidative damage of Drosophila melanogaster Exposed to Cd (VI). Real-time PCR and Western blot analysis showed that SNP enhanced the gene expression of Diptericin, Drosomycin, Defensin, PGRP-LC, and the protein level of Toll, p-JNK, and Relish，that suggested the promoting effect of SNP on the immune damage repair of Drosophila melanogaster exposed to Cd (VI). The increased level of Indy, Parkin and AMPK indicated the regulated effect of SNP on the longevity-related pathways through aging-related moleculars of Drosophila melanogaster exposed to Cd (VI). These results suggested that SNP could also improve the lifespan of Drosophila melanogaster exposed to Cd (VI).
Keywords: Polysaccharides; Sipunculus nudus; Lifespan; Drosophila melanogaster
S1
Experimental ......................................................................................................................................... S3 Tab.S1 Sequences of primers used in RT-PCR analysis. ....................................................................... S6 Tab.S2 Lifespan Extension effect of SNP on Drosophila melanogaster exposed to Cd (VI) ............... S7 Tab.S3 The anti-oxidative properties of SNP on Drosophila melanogaster exposed to Cd (VI) .......... S8 Fig. S1 The effect of SNP on Drosophila melanogaster exposed to Cd (VI) using Real-time PCR assay. ............................................................................................................................................................... S9 Fig. S2 The effect of SNP on Drosophila melanogaster exposed to Cd (VI) using Western Blot assay.. ............................................................................................................................................................. S10
S2
3.Experimental 3.1.
Isolation and Purification of the Polysaccharides
Referring to previous reports(Su J et al., 2016), S.nudus (diameter 6 ± 2 mm, length 10 ± 2 cm) were collected from Xiamen market, China (voucher specimen number: SN201408). Fresh peanut worms were washed, freeze dried, and crushed into powder. The powder was hydrolyzed by trypsin at 50 °C for 5 hours, and the insoluble material was removed by centrifugation. The supernatant liquor was deproteinized 4 times using the Sevage method(Staub,1965; aZhang and Dai, 2011). Next, we added 4 volumes of cold ethanol to precipitate the material after standing at 4 °C overnight(bZhang and Dai, 2011). The resulting precipitate was then centrifuged (3000 g × 10 min). After washing with ethanol 3 times, the precipitate was freeze-dried in vacuo and ground into a powder to produce a crude product. The crude product was subjected to a DEAE-Sepharose anion exchange column (3.0 cm × 40 cm), eluted at 0.5 ml/min successively with 0.0175 M pH 6.7 phosphate buffer solutions(without NaCl). Each fraction was collected with 2 ml of elute. The main elution fraction containing the carbohydrates was concentrated, dialyzed, and lyophilized. 3.2. Chemical component analysis Referring to previous reports(Su J et al., 2016), Neutral sugar content was measured, using glucose as the standard. Spectrophotometer(Purkinje General, Tu-1901) was used to detect the Optical Density(O.D) at 490 nm. Monosaccharide composition were analyzed by a Thero ICS-3000 ion chromatography system and identified and estimatedwith the monosaccharide standards (rhamnose, arabinose, glucose,galactose, xylose, Mannose) as the internal standard. 3.3. Fly Husbandry & Experimental Group Wild-type Drosophila melanogaster flies were obtained from the Shanghai Institute of Biochemistry and Cell Biology, SIBS, CAS. Flies were maintained under standard laboratory conditions of a 25°C temperature, 50%–70% relative humidity, and a 12 h light/dark cycle at all times with standard base diet. The flies were collected within 8h after eclosion and etherized, then sorted by random into 6 experimental groups for feeding. The experimental groups were set as follows: Group A: 1.0 μg/ml Cd (VI); Group B: 1.0 ug/ml Cd (VI) S3
+ 0.125mg/ml SNP; Group C: 1.0 μg/ml Cd (VI) + 0.25mg/ml SNP; Group D: 1.0 μg/ml Cd (VI) + 0.5mg/ml SNP; Group E: 1.0 μg/ml Cd (VI) + 150 mg/l Vitamin C; Group F: Blank control group. Corresponding agents were added to each group’s base diet. The blank control group (F) used a base diet. 3.4. Lifespan Assay For lifespan assays, each group had 90 individual flies that were placed into 3 polypropylene vials. Cultured diet was transferred once every 7 days, and the number of dead flies was recorded every day until all of the flies expired. The average time for flies to expire (died time) in each group was identified as the average lifespan. The average died time of the last 10 flies in each group was identified as the longest lifespan. 3.5. Biochemical index Assay Fifty mg of 10-day aged parental flies was collected after treatment of each group respectively, and 0.5 ml normal saline was added and homogenized in an ice bath. The homogenate was centrifuged at 3,000 r/min for 10 min to remove debris. The supernatant was obtained as the test sample for Superoxyde dismutase (SOD), Nitrogen monoxide (NO), Glutathione peroxidase (GSH-Px), total anti-oxidation competence(T-AOC), and malondialdehyde (MDA). 3.6. Quantitative Polymerase Chain Reaction Parental flies from each group were collected when they were 10 days old and triturated in liquid nitrogen. Total RNA was isolated from each sample using the Trizol Reagent according to the manufacturer’s protocol (TaKaRa, Dalian, China). The quality and quantity of total RNA was assessed. The RT-PCR was performed using a PrimeScript RT-PCR Kit according to the manufacturer’s instructions (Cat. No. RR036A, Takara, Dalian, China). Real-time PCR was carried out on a ViiA7 RT-PCR thermocycler (ViiA7, ABI, USA). The transcript level of each gene was calculated based on the Ct value and standard curve. The primer sequences for all genes were synthesized by Shanghai Sangon Biotech Company, Ltd. (shown in Tab.S1). 3.7. Western Blot Analysis In the Western blot analysis, 10-day old parental flies from each group were harvested to extract the protein. The concentration of protein per group was determined using a BCA protein assay kit according to the manufacturer’s protocol (Cat. No. P0010, Beyotime, Shanghai, China). Protein levels of Relish, Toll, Parkin, AMPK (antibodies from Santa Cruz), and p-JNK (antibodies from Abcam) S4
were analyzed by Western blot analysis as described previously(Su J et al. 2016). Immune complexes were visualized with an enhanced chemiluminescence detection system. 3.8. Statistical Analysis Data are expressed as means ± standard deviation (S.D.). Student’s t-test was performed to analyze the differences between the control and test groups. Differences were considered to be statistically significant at P < 0.05 (or P < 0.01).
S5
Tab.S1 Sequences of primers used in RT-PCR analysis. Gene
Primer sequences
Diptericin F
GACGCCACGAGATTGGACT
diptericin R
TAGGTGTAGGTGCTTCCCACTT
Drosomycin F
TACTTGTTCGCCCTCTTCG
Drosomycin R
CAGGTCTCGTTGTCCCAGA
Defensin F
AGTGGAACTGGAACCACACC
Defensin R
CACAGAGCGAAACGAAATCA
PGRP-LC F
CCCTGACCAACTCCACAGAT
PGRP-LC R
GGTTTCCACTTGTCCCGATT
Indy F
TTCTACTCGGTGCCATCCAT
Indy R
CTGTGCCTCCTTGCTCTTG
Gapdh F
TGACGAAATCAAGGCTAAGGT
Gapdh R
GCTGAAGAAGTCGGTGGAGA
S6
Tab.S2 Lifespan Extension effect of SNP on Drosophila melanogaster exposed to Cd (VI)
Experimental Group
Average Lifespan
Extension
Longest Lifespan
Extension
（d）
(%)
（d）
(%)
A Cd (VI) 1.0 μg/ml
10.3±0.8
B Cd (VI) 1.0 μg/ml + SNP 0.125mg/ml
16.2±1.2 b
57.3
25.5±2.5 a
57.4
C Cd (VI) 1.0 μg/ml + SNP 0.25mg/ml
20.6±2.3 b
100.0
30.9±2.6 b
90.7
D Cd (VI) 1.0 μg/ml + SNP 0.5mg/ml
24.8±2.2 a
140.8
33.4±3.2 c
106.2
E Cd (VI) 1.0 μg/ml +Vc 150mg/l
12.6±1.8 c
22.3
19.4±4.1 c
19.8
F Blank control
24.0±1.4 b
133.0
35.7±0.7 b
120.4
16.2±3.7
a
P value
a
South China Sea Bio-Resource Exploitation and Utilization Collaborative Innovation Center, School
of Life Sciences, Guangdong Provincial Key Laboratoryof Marine Resources and Coastal Engineering, Zhuhai Key Laboratory of Marine Bioresources and Environment, School of Marine Sciences, Sun Yat-SenUniversity, Guangzhou 519000, PR China
b
Key Laboratory of Cultivation and High-value Utilization of Marine Organisms in Fujian Province,
Fujian Collaborative Innovation Center for Exploitationand Utilization of Marine Biological Resources, Fisheries Research Institute of Fujian, Xiamen, Fujian 361012, PR China
Abstract：The water-soluble polysaccharides extracted from Sipunculus nudus(SNP) was investigated on the lifespan and immune damage repair of Drosophila melanogaster exposed to Cd (VI). SNP increased Superoxyde dismutase (SOD), Nitrogen monoxide (NO), Glutathione peroxidase (GSH-Px), and total anti-oxidation competence(T-AOC), with decreased malondialdehyde (MDA) on Drosophila melanogaster demonstrated that SNP could attenuated oxidative damage of Drosophila melanogaster Exposed to Cd (VI). Real-time PCR and Western blot analysis showed that SNP enhanced the gene expression of Diptericin, Drosomycin, Defensin, PGRP-LC, and the protein level of Toll, p-JNK, and Relish，that suggested the promoting effect of SNP on the immune damage repair of Drosophila melanogaster exposed to Cd (VI). The increased level of Indy, Parkin and AMPK indicated the regulated effect of SNP on the longevity-related pathways through aging-related moleculars of Drosophila melanogaster exposed to Cd (VI). These results suggested that SNP could also improve the lifespan of Drosophila melanogaster exposed to Cd (VI).
Keywords: Polysaccharides; Sipunculus nudus; Lifespan; Drosophila melanogaster
S1
Experimental ......................................................................................................................................... S3 Tab.S1 Sequences of primers used in RT-PCR analysis. ....................................................................... S6 Tab.S2 Lifespan Extension effect of SNP on Drosophila melanogaster exposed to Cd (VI) ............... S7 Tab.S3 The anti-oxidative properties of SNP on Drosophila melanogaster exposed to Cd (VI) .......... S8 Fig. S1 The effect of SNP on Drosophila melanogaster exposed to Cd (VI) using Real-time PCR assay. ............................................................................................................................................................... S9 Fig. S2 The effect of SNP on Drosophila melanogaster exposed to Cd (VI) using Western Blot assay.. ............................................................................................................................................................. S10
S2
3.Experimental 3.1.
Isolation and Purification of the Polysaccharides
Referring to previous reports(Su J et al., 2016), S.nudus (diameter 6 ± 2 mm, length 10 ± 2 cm) were collected from Xiamen market, China (voucher specimen number: SN201408). Fresh peanut worms were washed, freeze dried, and crushed into powder. The powder was hydrolyzed by trypsin at 50 °C for 5 hours, and the insoluble material was removed by centrifugation. The supernatant liquor was deproteinized 4 times using the Sevage method(Staub,1965; aZhang and Dai, 2011). Next, we added 4 volumes of cold ethanol to precipitate the material after standing at 4 °C overnight(bZhang and Dai, 2011). The resulting precipitate was then centrifuged (3000 g × 10 min). After washing with ethanol 3 times, the precipitate was freeze-dried in vacuo and ground into a powder to produce a crude product. The crude product was subjected to a DEAE-Sepharose anion exchange column (3.0 cm × 40 cm), eluted at 0.5 ml/min successively with 0.0175 M pH 6.7 phosphate buffer solutions(without NaCl). Each fraction was collected with 2 ml of elute. The main elution fraction containing the carbohydrates was concentrated, dialyzed, and lyophilized. 3.2. Chemical component analysis Referring to previous reports(Su J et al., 2016), Neutral sugar content was measured, using glucose as the standard. Spectrophotometer(Purkinje General, Tu-1901) was used to detect the Optical Density(O.D) at 490 nm. Monosaccharide composition were analyzed by a Thero ICS-3000 ion chromatography system and identified and estimatedwith the monosaccharide standards (rhamnose, arabinose, glucose,galactose, xylose, Mannose) as the internal standard. 3.3. Fly Husbandry & Experimental Group Wild-type Drosophila melanogaster flies were obtained from the Shanghai Institute of Biochemistry and Cell Biology, SIBS, CAS. Flies were maintained under standard laboratory conditions of a 25°C temperature, 50%–70% relative humidity, and a 12 h light/dark cycle at all times with standard base diet. The flies were collected within 8h after eclosion and etherized, then sorted by random into 6 experimental groups for feeding. The experimental groups were set as follows: Group A: 1.0 μg/ml Cd (VI); Group B: 1.0 ug/ml Cd (VI) S3
+ 0.125mg/ml SNP; Group C: 1.0 μg/ml Cd (VI) + 0.25mg/ml SNP; Group D: 1.0 μg/ml Cd (VI) + 0.5mg/ml SNP; Group E: 1.0 μg/ml Cd (VI) + 150 mg/l Vitamin C; Group F: Blank control group. Corresponding agents were added to each group’s base diet. The blank control group (F) used a base diet. 3.4. Lifespan Assay For lifespan assays, each group had 90 individual flies that were placed into 3 polypropylene vials. Cultured diet was transferred once every 7 days, and the number of dead flies was recorded every day until all of the flies expired. The average time for flies to expire (died time) in each group was identified as the average lifespan. The average died time of the last 10 flies in each group was identified as the longest lifespan. 3.5. Biochemical index Assay Fifty mg of 10-day aged parental flies was collected after treatment of each group respectively, and 0.5 ml normal saline was added and homogenized in an ice bath. The homogenate was centrifuged at 3,000 r/min for 10 min to remove debris. The supernatant was obtained as the test sample for Superoxyde dismutase (SOD), Nitrogen monoxide (NO), Glutathione peroxidase (GSH-Px), total anti-oxidation competence(T-AOC), and malondialdehyde (MDA). 3.6. Quantitative Polymerase Chain Reaction Parental flies from each group were collected when they were 10 days old and triturated in liquid nitrogen. Total RNA was isolated from each sample using the Trizol Reagent according to the manufacturer’s protocol (TaKaRa, Dalian, China). The quality and quantity of total RNA was assessed. The RT-PCR was performed using a PrimeScript RT-PCR Kit according to the manufacturer’s instructions (Cat. No. RR036A, Takara, Dalian, China). Real-time PCR was carried out on a ViiA7 RT-PCR thermocycler (ViiA7, ABI, USA). The transcript level of each gene was calculated based on the Ct value and standard curve. The primer sequences for all genes were synthesized by Shanghai Sangon Biotech Company, Ltd. (shown in Tab.S1). 3.7. Western Blot Analysis In the Western blot analysis, 10-day old parental flies from each group were harvested to extract the protein. The concentration of protein per group was determined using a BCA protein assay kit according to the manufacturer’s protocol (Cat. No. P0010, Beyotime, Shanghai, China). Protein levels of Relish, Toll, Parkin, AMPK (antibodies from Santa Cruz), and p-JNK (antibodies from Abcam) S4
were analyzed by Western blot analysis as described previously(Su J et al. 2016). Immune complexes were visualized with an enhanced chemiluminescence detection system. 3.8. Statistical Analysis Data are expressed as means ± standard deviation (S.D.). Student’s t-test was performed to analyze the differences between the control and test groups. Differences were considered to be statistically significant at P < 0.05 (or P < 0.01).
S5
Tab.S1 Sequences of primers used in RT-PCR analysis. Gene
Primer sequences
Diptericin F
GACGCCACGAGATTGGACT
diptericin R
TAGGTGTAGGTGCTTCCCACTT
Drosomycin F
TACTTGTTCGCCCTCTTCG
Drosomycin R
CAGGTCTCGTTGTCCCAGA
Defensin F
AGTGGAACTGGAACCACACC
Defensin R
CACAGAGCGAAACGAAATCA
PGRP-LC F
CCCTGACCAACTCCACAGAT
PGRP-LC R
GGTTTCCACTTGTCCCGATT
Indy F
TTCTACTCGGTGCCATCCAT
Indy R
CTGTGCCTCCTTGCTCTTG
Gapdh F
TGACGAAATCAAGGCTAAGGT
Gapdh R
GCTGAAGAAGTCGGTGGAGA
S6
Tab.S2 Lifespan Extension effect of SNP on Drosophila melanogaster exposed to Cd (VI)
Experimental Group
Average Lifespan
Extension
Longest Lifespan
Extension
（d）
(%)
（d）
(%)
A Cd (VI) 1.0 μg/ml
10.3±0.8
B Cd (VI) 1.0 μg/ml + SNP 0.125mg/ml
16.2±1.2 b
57.3
25.5±2.5 a
57.4
C Cd (VI) 1.0 μg/ml + SNP 0.25mg/ml
20.6±2.3 b
100.0
30.9±2.6 b
90.7
D Cd (VI) 1.0 μg/ml + SNP 0.5mg/ml
24.8±2.2 a
140.8
33.4±3.2 c
106.2
E Cd (VI) 1.0 μg/ml +Vc 150mg/l
12.6±1.8 c
22.3
19.4±4.1 c
19.8
F Blank control
24.0±1.4 b
133.0
35.7±0.7 b
120.4
16.2±3.7
a
P value
