Supporting Information A simple tagging system for ... AWS
Supporting Information A simple tagging system for protein encapsulation Florian P. Seebeck§, Kenneth J. Woycechowsky§, Wei Zhuang‡, Jürgen P. Rabe‡ and Donald Hilvert§* §
Laboratorium für Organische Chemie, ETH Zürich, Hönggerberg HCI F337, CH-8093, Zürich,
Switzerland; ‡Department of Physics, Humboldt University Berlin, Newtonstrasse 15, D-12489 Berlin, Germany. *e-mail: [email protected] Materials. Buffers and salts were purchased from Sigma, J.T. Baker, or Fluka and used without further purification. Oligonucleotides were custom-synthesized and purified by MicroSynth (Balgach, Switzerland). Restriction enzymes were from New England BioLabs (Fankfurt, Germany). DNA polymerase was from Stratagene (Amsterdam, the Netherlands). Recombinant lumazine synthase from Aquifex aeolicus. The lumazine synthase gene from A. aeolicus was amplified from plasmid pNCO-AA-ribH,1 by PCR using the primers 200304AQS (GATATACCATGGAAATCTACGAAGGTAAACTA) and 200304AQA (GATATACTCGAGTCGGAGAGACTTGAATAAGT). The restriction sites are underlined. The NcoI/XhoI double digested fragment was ligated into a modified version of the pMG209 vector.2 Mutations R83E, T86E, Q123E and T120E were introduced by standard overlap-extension PCR using Pfu-polymerase and the following additional primers: 200304NEG1 (GTTCTCATCGAAGGGGCAGAGCCACATTTC), 200304NEG2
(GAAATGTGGCTCTGCCCCTTCGATGAGAAC),
203004NEG3
S1
(CAGCTGACGAATTGGAAGAGGCTATCGAG)
and
203004NEG4
(CTCGATAGCCTCTTCCAATTCGTCAGCTG). The altered codons are shown in bold. All coding portions of the constructed plasmids were confirmed by DNA sequencing. Recombinant GFP-R10. The plasmid pMG-GFP3 encodes GFP from Aequorea victoria with an inframe, C-terminal His-tag. We replaced the His-tag with a deca-arginine tag by ligating a duplex of the primers
220304polyRs
(TCGAGCGTAGACGACGCCGTCGGCGACGTCGACGTTAA)
and
220304polyRa (CTAGTTAACGTCGACGTCGCCGACGGCGTCGTCTACGC) into pMG-GFP that was linearized by double digestion with XhoI and SpeI. The resulting low copy number plasmid (pAC4C-GFP-R) encodes GFP-R10 (under control of the T7 and salicylate promoters) and also chloramphenicol resistance. This plasmid served as a template for site-directed mutagenesis in order to generate a construct (pAC4C-GFP) encoding GFP that lacks any C-terminal tag. Mutations (in bold) were introduced using the QuickChangeTM site-directed mutagenesis kit (Stratagene) with the primers 050804killargS (CTCGAGCGTTAACGACGCCGT) and 050804killargA (ACGGCGTCGTTAACGCTCGAG). Protein production. Calcium competent E. coli cells (BL21) were transformed with pMG-ALS (encoding either AaLS-wt or AaLS-neg) and/or pAC4C-GFP-R. The recombinant proteins were overproduced upon induction with 0.1mM IPTG and 0.1 mM salicylate in 250 mL cultures grown at 30 ºC in LB medium supplemented with ampicillin (150 mg/L) and/or chloramphenicol (50 mg/L). Cell pellets were suspended in 4 mL loading buffer (50 mM sodium phosphate 300 mM NaCl, pH 8.0) and lysed by incubation with 2 mg lysozyme and 0.5 mg DNase at room temperature followed by ultrasonication. Cleared cell lysates were incubated with 2 mL Ni2+-NTA-agarose resin (Qiagen), which was preequilibrated with 10 mg BSA in loading buffer to increase specificity. After 20 min incubation, this suspension was loaded on polystyrene chromatography columns that were then washed with 100 mL loading buffer, 20 mL loading buffer containing 40 mM imidazole, and eluted with 3 mL loading buffer containing 500 mM imidazole. Protein purity was assessed by SDS-PAGE (Figure S1). Protein S2
concentrations were determined using the Coomassie Plus Protein Assay Reagent (Pierce) with bovine serum albumin (BSA) as a standard. Typically, a 250 mL culture yielded 5 mg of purified protein. The proteins were dialyzed into pH 8.0 buffer (containing 50 mM sodium phosphate, 5 mM EDTA, and 200 mM NaCl) at 25 ºC, and then stored at 4 ºC until use. Specific GFP concentrations were determined by fluorescence spectroscopy using a standard curve obtained with purified GFP. Fluorescence measurements were carried out at excitation and emission wavelengths of 450 nm and 500 nm, respectively, with a bandpass of 4 nm. High voltage was set to 850 V. When AaLS-neg was co-produced with GFP-R10, purified by Ni2+-affinity chromatography, and analyzed by SDS-PAGE, bands for both proteins were visible in the gel. This affinity-purified sample also displayed GFP-based fluorescence corresponding to 15 µg GFP-R10 per mL NTA-agarose. In contrast, when AaLS-wt and GFP-R10 were co-produced, affinity-purified, and analyzed by SDS-PAGE, the band for GFP-R10 was not apparent on the gel. The fluorescence intensity of this sample indicated a yield of D/2 or by Equation 4 when R < D/2. 2α represents the tip peak angle, which is typically about 35°. This correction yields average particle sizes: 10.4 ± 5.1 nm for small, 19.7 ± 9.1 nm for middle and 31.4 ± 6.8 nm for large particles. Equation 3:
D=
W2 8R
Equation 4: 1 + sin α 1 − sin α D( ) = W − 2 R( ) cos α cos α
Analysis of the two-dimensional shape for each particle in the SFM image revealed that 90% of AaLS-wt particles possessed a circular shape (a deviation between the longest diameter and the shortest axis of
Laboratorium für Organische Chemie, ETH Zürich, Hönggerberg HCI F337, CH-8093, Zürich,
Switzerland; ‡Department of Physics, Humboldt University Berlin, Newtonstrasse 15, D-12489 Berlin, Germany. *e-mail: [email protected] Materials. Buffers and salts were purchased from Sigma, J.T. Baker, or Fluka and used without further purification. Oligonucleotides were custom-synthesized and purified by MicroSynth (Balgach, Switzerland). Restriction enzymes were from New England BioLabs (Fankfurt, Germany). DNA polymerase was from Stratagene (Amsterdam, the Netherlands). Recombinant lumazine synthase from Aquifex aeolicus. The lumazine synthase gene from A. aeolicus was amplified from plasmid pNCO-AA-ribH,1 by PCR using the primers 200304AQS (GATATACCATGGAAATCTACGAAGGTAAACTA) and 200304AQA (GATATACTCGAGTCGGAGAGACTTGAATAAGT). The restriction sites are underlined. The NcoI/XhoI double digested fragment was ligated into a modified version of the pMG209 vector.2 Mutations R83E, T86E, Q123E and T120E were introduced by standard overlap-extension PCR using Pfu-polymerase and the following additional primers: 200304NEG1 (GTTCTCATCGAAGGGGCAGAGCCACATTTC), 200304NEG2
(GAAATGTGGCTCTGCCCCTTCGATGAGAAC),
203004NEG3
S1
(CAGCTGACGAATTGGAAGAGGCTATCGAG)
and
203004NEG4
(CTCGATAGCCTCTTCCAATTCGTCAGCTG). The altered codons are shown in bold. All coding portions of the constructed plasmids were confirmed by DNA sequencing. Recombinant GFP-R10. The plasmid pMG-GFP3 encodes GFP from Aequorea victoria with an inframe, C-terminal His-tag. We replaced the His-tag with a deca-arginine tag by ligating a duplex of the primers
220304polyRs
(TCGAGCGTAGACGACGCCGTCGGCGACGTCGACGTTAA)
and
220304polyRa (CTAGTTAACGTCGACGTCGCCGACGGCGTCGTCTACGC) into pMG-GFP that was linearized by double digestion with XhoI and SpeI. The resulting low copy number plasmid (pAC4C-GFP-R) encodes GFP-R10 (under control of the T7 and salicylate promoters) and also chloramphenicol resistance. This plasmid served as a template for site-directed mutagenesis in order to generate a construct (pAC4C-GFP) encoding GFP that lacks any C-terminal tag. Mutations (in bold) were introduced using the QuickChangeTM site-directed mutagenesis kit (Stratagene) with the primers 050804killargS (CTCGAGCGTTAACGACGCCGT) and 050804killargA (ACGGCGTCGTTAACGCTCGAG). Protein production. Calcium competent E. coli cells (BL21) were transformed with pMG-ALS (encoding either AaLS-wt or AaLS-neg) and/or pAC4C-GFP-R. The recombinant proteins were overproduced upon induction with 0.1mM IPTG and 0.1 mM salicylate in 250 mL cultures grown at 30 ºC in LB medium supplemented with ampicillin (150 mg/L) and/or chloramphenicol (50 mg/L). Cell pellets were suspended in 4 mL loading buffer (50 mM sodium phosphate 300 mM NaCl, pH 8.0) and lysed by incubation with 2 mg lysozyme and 0.5 mg DNase at room temperature followed by ultrasonication. Cleared cell lysates were incubated with 2 mL Ni2+-NTA-agarose resin (Qiagen), which was preequilibrated with 10 mg BSA in loading buffer to increase specificity. After 20 min incubation, this suspension was loaded on polystyrene chromatography columns that were then washed with 100 mL loading buffer, 20 mL loading buffer containing 40 mM imidazole, and eluted with 3 mL loading buffer containing 500 mM imidazole. Protein purity was assessed by SDS-PAGE (Figure S1). Protein S2
concentrations were determined using the Coomassie Plus Protein Assay Reagent (Pierce) with bovine serum albumin (BSA) as a standard. Typically, a 250 mL culture yielded 5 mg of purified protein. The proteins were dialyzed into pH 8.0 buffer (containing 50 mM sodium phosphate, 5 mM EDTA, and 200 mM NaCl) at 25 ºC, and then stored at 4 ºC until use. Specific GFP concentrations were determined by fluorescence spectroscopy using a standard curve obtained with purified GFP. Fluorescence measurements were carried out at excitation and emission wavelengths of 450 nm and 500 nm, respectively, with a bandpass of 4 nm. High voltage was set to 850 V. When AaLS-neg was co-produced with GFP-R10, purified by Ni2+-affinity chromatography, and analyzed by SDS-PAGE, bands for both proteins were visible in the gel. This affinity-purified sample also displayed GFP-based fluorescence corresponding to 15 µg GFP-R10 per mL NTA-agarose. In contrast, when AaLS-wt and GFP-R10 were co-produced, affinity-purified, and analyzed by SDS-PAGE, the band for GFP-R10 was not apparent on the gel. The fluorescence intensity of this sample indicated a yield of D/2 or by Equation 4 when R < D/2. 2α represents the tip peak angle, which is typically about 35°. This correction yields average particle sizes: 10.4 ± 5.1 nm for small, 19.7 ± 9.1 nm for middle and 31.4 ± 6.8 nm for large particles. Equation 3:
D=
W2 8R
Equation 4: 1 + sin α 1 − sin α D( ) = W − 2 R( ) cos α cos α
Analysis of the two-dimensional shape for each particle in the SFM image revealed that 90% of AaLS-wt particles possessed a circular shape (a deviation between the longest diameter and the shortest axis of
