Synthesis of infectious RNA from full-length cloned ... - Semantic Scholar
Journal of General Virology (1990), 71, 1857-1860.
1857
Printed in Great Britain
Synthesis of infectious RNA from full-length cloned cDNA to RNA of cymbidium ringspot tombusvirus Jbzsef Burgyan, t Peter D. Nagyt and Marcello Russo* Dipartimento di Patologia Vegetale, Via Amendola 165/A, Universith degli Studi and Centro di Studio del CNR sui Virus e le Virosi delle Colture Mediterranee, 70126 Bari, Italy
A full-length DNA copy of cymbidium ringspot virus RNA was cloned downstream of a phage T7 promoter. In vitro transcripts had no extra nucleotides at the 3' terminus, and a 5' end likely to be precisely as in genomic RNA. Transcripts were infective when inoculated into test plants. Northern blots from inoculated
plants revealed the presence of genomic and subgenomic RNAs, but not of satellite RNA. Virus particles isolated from infected plants had the same outward aspect and size as those of the wild-type virus and were decorated by an antiserum to CyRSV in immune electron microscopy tests.
Cymbidium ringspot virus (CyRSV) is a member of the tombusvirus group (Martelli et al., 1989). The main features of expression of the genetic information (Burgyan et al., 1986; Russo et al., 1988) as well as its complete nucleotide sequence have been determined (Grieco et al., 1989a). To obtain a better insight into the functions of viral genes, and the roles of specific sequences in encapsidation, replication and translation, full-length clones of the CyRSV genome were prepared. This paper reports that the full-length clones yielded infectious RNA transcripts with no extraviral nucleotides at the 5' and 3' ends. CyRSV genomic RNA was obtained as described by Russo et al. (1988). A procedure basically similar to that described by Ahlquist & Janda (1984) was used for cloning the 5' end region: first strand synthesis was primed with the oligonucleotide 5' GGTAGACCCTGCCTTCA 3' complementary to nucleotides 104 to 120 of genomic RNA; hybrid R N A - D N A was melted at 100 °C for 1 min, and digested with ribonuclease A. Second strand synthesis was primed by the oligonucleotide 5' ATCGATAATACGACTCACTATAGGAAATCCTCCAGGACA Y, containing 17 bases homologous to the first 17 bases of genomic RNA, 17 bases constituting the T7 promoter consensus (Dunn & Studier, 1983) and five additional bases contributing to formation of a ClaI site. dsDNA was inserted in pUC18 digested with Sinai to produce the clone pCyR-T7. A fragment AccI-KpnI was eluted from a clone (pCyR-
102), previously obtained (Russo et al., 1988), which was ligated to clone pCyR-T7 digested with the same enzymes to obtain clone pCyR-T7/102. This clone was extended by the addition of the fragment KpnI-BamH I from an available clone (pCyR-251), that had been produced by priming first strand synthesis with the oligonucleotide 5' CCTTCTCACAAACTGCT Y, complementary to nucleotides 1351 to 1367 in genomic RNA. Second strand synthesis was carried out in the presence of ribonuclease H and polymerase I according to Gubler & Hoffman (1983). The clone thus obtained is pCyRT7/B. A fragment BamHI-SmaI from clone pCyR-1 (Russo et al., 1988) was ligated to BamHI-SmaI-digested clone pCyR-T7/B to make clone pCyR-T7/S. Finally, the 3' region was obtained by priming first strand synthesis with the oligonucleotide 5' GCATGCCCCTGCATTGCTGCAA 3', which is complementary to 17 bases of CyRSV RNA and has five additional nucleotides, forming a restriction site SphI, which does not occur in the CyRSV sequence (Grieco et al., 1989a). Digestion with SphI cut the D N A immediately after the last G of the genomic RNA. Second strand synthesis was done as before (Gubler & Hoffman, 1983) and cloning was in Sinai-digested pUC18. A fragment Smal-SphI was cut from one such clone (pCyR-SH) and ligated to pCyR-7/S to have full-length clone pCyR-G. The cloning procedure is summarized in Fig. 1 (a). The terminal sequences of pCyR-G (Fig. 1b) were determined by sequencing clones pCyR-T7 and pCyR-SH by the chain termination method (Sanger et al., 1977) using modified T7 polymerase (Sequenase, US Biochemicals). Transcription was made to start with a G residue,
"{"Permanent address: Research Institute for Plant Protection. P.O. Box 102, H-1525 Budapest, Hungary. 0000-9549 © 1990 SGM
1858
Short communication
(a) l
l
2 |
I
3 I
!
Acid KplnI
4 I i
OamHl
kb
I
SmaI
T7 pCyR-T7 I1-"l pCyR-102 T7 p C y R ~ 7 / 1 0 2 ll"-i
T7 •
pCyR-251
pCyR-T7/B pCyR-I
T7 •
pCyR-T7/S pCyR-SH
i T7
I
Sphl
pCyR-G
•
I Sphl
(b) atcgaTAATACGACTCACTATAGGAAATCCTCCAGGACA ..... Clal T7 promoter ( G ) G A A A T C C T C C A G G A C A ..... CyRSV sequence ...... TTGCAGCAATGCAGGGG
catglc
3' end of transcript
ct gtac g
Sph~
Fig. 1. Construction of a full-length copy of CyRSV RNA. (a) Schematic representation of the ligation steps made to prepare full-size DNA clones. Upper line represents genomic RNA with relevant restriction sites. Open bars at 5' and 3' regions are clones prepared in the course of the present work fused lo previous clones (closed bars) of which only the parts of inserts used are shown, (b) Nucleotide sequences of the 5' and 3' termini of full-length clone pCyR-G, showing transcription start site (bent arrow) and end of run-off transcripts. The 5' terminus, G, is shown in parentheses to indicate uncertainty in the assignment of this base,
although the 5' terminus of CyRSV R N A is not known (Grieco et al., 1989a). The run-off transcripts were expected to have authentic 3' termini since they can be produced after linearization with SphI which cuts inserts precisely at the 3' end of genome. Plasmids were purified as described previously (Grieco et al., 1989b) and digested with SphI. Transcription with T7 R N A polymerase was done using a kit from Amersham, essentially as described by the supplier. Capped transcripts were obtained by adding to the reaction the cap analogue mTGpppG (Boehringer Mannheim) at 500 ~tM, and lowering GTP concentration to one-eighth the concentration of the other ribonucleotides. After 1 h incubation at 37 °C, transcripts were extracted wtih phenol and chloroform, precipitated with ethanol and dissolved in water or inoculated directly to test plants. R N A size and concentration were estimated from ethidium bromide-stained gels by visual comparison with positions and band intensities produced by known quantities of viral RNA. RNA synthesized in vitro from clone pCyR-G co-electrophoresed with CyRSV genomic RNA (data not shown). Approximately
2 gg R N A was obtained from 1 pg linearized plasmid. Messenger activity of transcripts was tested in rabbit reticulocyte lysates as previously described (Burgyan et al., 1986), except that the labelled amino acid was [3H]leucine (Amersham; 135 Ci/mmol). Uncapped and capped full-length transcripts yielded a labelled product that electrophoresed with Mr 33000 obtained by translation of viral genomic RNA (Burgyan et al., 1986 (data not shown). Transcripts at a concentration of approximately 200 ~tg/ml were mixed with 1 volume of inoculation buffer (0-05 M-glycine, 0-03 M-KzHPO4, pH 9-2; Heaton et al., 1989) and inoculated into the systemic hosts Nicotiana clevelandii and N. benthamiana (10 ~tl/leaf). Plants inoculated with transcripts developed symptoms 7 to 8 days after inoculation that were identical to those induced by the original isolate, i.e. chlorotic/necrotic lesions in inoculated leaves, followed by systemic distortion and crinkling. Leaf-dip preparations from systemic infections showed the presence of isometric particles that were clearly decorated (Milne & Luisoni, 1977) by an antiserum to CyRSV. The specific infectivity
Short communication
1859
(a) 1
2
3
4
5
(b)
(c) 1
3
4
5
6
1
2
3
4
5
6
-S
--S
Fig. 2. RNA species in plants infected with CyRSV RNA in vitro transcripts. (a) Ethidium bromide-stained agarose gel. (b and c) Northern blots hybridized with probes pCyR-7 of genomic RNA and pCS19 of satellite RNA, respectively. Lanes 1, viral RNA from satellite-free CyRSV; lanes 2 and 3, total RNA from N. clevelandii and N. benthamiana plants, respectively, inoculated with pCyR-G transcript; lanes 4 and 5, RNA from uninoculated N. clevelandii and N. benthamiana plants, respectively; lanes 6, viral RNA from satellite-containing CyRSV. G, sgl, sg2, and S: positions of genomic, subgenomic and satellite RNAs, respectively.
of RNA synthesized/n vitro was estimated by inoculating opposite leaves of Chenopodium quinoa in a random design with transcripts and known concentrations of viral RNA. The average numbers of lesions/~tg RNA/ leaf of capped and uncapped transcripts were 11 and 6, respectively, which was lower than the number induced by control viral RNA (62 lesions). RNA was extracted from plants showing symptoms as described (Russo et al., 1988; Burgyan & Russo, 1988). Samples were denatured with 50~ formamide at 65 °C for 5 min, electrophoresed in 1.2% agarose in 90 mMTris, 90 mM-boric acid, 1 mM-EDTA and stained with ethidium bromide or denatured with formamide and formaldehyde, electrophoresed in 1.2% agarose in MOPS buffer (20 mM-MOPS, 5 mM-sodium acetate, 1 mM-EDTA) containing 2.2 M-formaldehyde (Maniatis et al., 1982) and blotted onto nylon membranes (Amersham). Ethidium bromide-stained agarose gels of R N A extracted from systemically infected leaves showed the presence in inoculated tissues of a strong band at the position of CyRSV genomic RNA (Fig. 2a). Northern blots were hybridized with two nick-translated (Maniatis et al., 1982) cloned probes: pCyR-7, representing the 3'terminal 1000 nucleotides of genomic RNA (Russo et al., 1988), and pCS19, a partial clone of satellite RNA (Rubino et al., 1990). Blots probed with clone pCyR-7 showed genomic and subgenomic RNAs typical of CyRSV infections (Russo et al., 1988) (Fig. 2b, lanes 2 and 3), whereas no satellite RNA could be detected with the specific probe pCS19 (Fig. 2c). It has been shown that when satellite-free isolates of tomato bushy stunt tombusvirus were inoculated into N. benthamiana and into N. clevelandii the virus acquired satellite R N A in the
former case but not in the latter (Gallitelli & Hull, t985), This may not be the case for CyRSV, since both N. benthamiana and N. clevelandii remained satellite-free upon inoculation with in vitro transcripts of CyRSV genomic RNA. Moreover, no satellite RNA was found after four passages of the virus after the first infection with transcripts (data not shown). The results of the present study show the potential of in vitro transcripts of full-length clones of CyRSV. This opens the possibility of studying the generation of defective interfering and satellite RNAs as well as mapping viral functions and understanding the role of specific sequences that control the synthesis of subgenomic RNAs. We thank Dr F. Grieco and Professor G. P. MarteUi, who also revised the manuscript, for helpful discussions during the course of the present work. P. D. Nagy is in receipt of a fellowship from the International Centre for Genetic Engineering and Biotechnology (UNIDO).
References AHLQUIST, P. & JANDA, M. (1984). cDNA cloning and in vitro transcription of the complete brome mosaic virus genome. Molecular and Cellular Biology 4, 2876-2882. BURGYAN, J. & RuSso, M. (1988). Studies on the replication of a satellite RNA associated with cymbidium ringspot virus. Journal of General Virology 69, 3089 3092. BURGYAN, J., RUSSO, M. & GALLITELLI, D. (1986). Translation of cymbidium ringspot virus RNA in cowpea protoplasts and rabbit reticulocyte lysates. Journal of General Virology 67, 1149-1160. DUNN, J. J. & STUDIER,F. W. (1983). Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements. Journal of Molecular Biology 166, 477-485.
1860
Short communication
GALLITELLI,D. & HULL, R. (1985). Characterization of satellite RNAs associated with tomato bushy stunt virus and five other definitive tombusviruses. Journal of General Virology 66, 1533-1543. GRIECO, F., BURGYAN, J. & RUSSO, M. (1989a). The nucleotide sequence of cymbidium ringspot virus RNA. Nucleic Acids Research 17, 6383. GRIECO,F., BURGYAN,J. t~;RUSSO,M. (1989b). Nucleotide sequence of the T-terminal region of cymbidium ringspot virus RNA. Journal of General Virology 70, 2533-2538. GUBLER, U. & HOFFMAN,B. J. (1983). A simple and very efficient method for generating cDNA libraries. Gene 25, 263 269. HEATON, L. A., CARRINGTON,J. C. & MORRIS, T. J. (1989). Turnip crinkle virus infection from RNA synthesized in vitro. Virology 170, 214-218. MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory.
MARTELLI, G. P., RUSSO, M. & GALLITELLI,D. (1989). Tombusvirus group. AAB Descriptions of Plant Viruses, no. 352. MILNE, R. G. & LUISONI, E. (1977). Rapid immune electron microscopy of virus preparations. Methods in Virology 6, 265-281. RUBINO, L., BURGYAN,J., GRIECO, F. & RUSSO,M. (1990). Sequence analysis of cymbidium ringspot virus satellite and defective interfering RNAs. Journal of General Virology 71, 1655-1660. RUSSO, M., BURGYAN, J., CARRINGTON, J. C., HILLMAN, B. I. & MORRIS,T. J. (1988). Complementary DNA cloning and characterization of cymbidium ringspot virus RNA. JournalofGeneral Virology 69, 401-406. SANGER,F., NICKLEN,S. & COULSON,A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, U.S.A. 74, 5463-5467.
(Received 27 February 1990; Accepted 19 April 1990)
1857
Printed in Great Britain
Synthesis of infectious RNA from full-length cloned cDNA to RNA of cymbidium ringspot tombusvirus Jbzsef Burgyan, t Peter D. Nagyt and Marcello Russo* Dipartimento di Patologia Vegetale, Via Amendola 165/A, Universith degli Studi and Centro di Studio del CNR sui Virus e le Virosi delle Colture Mediterranee, 70126 Bari, Italy
A full-length DNA copy of cymbidium ringspot virus RNA was cloned downstream of a phage T7 promoter. In vitro transcripts had no extra nucleotides at the 3' terminus, and a 5' end likely to be precisely as in genomic RNA. Transcripts were infective when inoculated into test plants. Northern blots from inoculated
plants revealed the presence of genomic and subgenomic RNAs, but not of satellite RNA. Virus particles isolated from infected plants had the same outward aspect and size as those of the wild-type virus and were decorated by an antiserum to CyRSV in immune electron microscopy tests.
Cymbidium ringspot virus (CyRSV) is a member of the tombusvirus group (Martelli et al., 1989). The main features of expression of the genetic information (Burgyan et al., 1986; Russo et al., 1988) as well as its complete nucleotide sequence have been determined (Grieco et al., 1989a). To obtain a better insight into the functions of viral genes, and the roles of specific sequences in encapsidation, replication and translation, full-length clones of the CyRSV genome were prepared. This paper reports that the full-length clones yielded infectious RNA transcripts with no extraviral nucleotides at the 5' and 3' ends. CyRSV genomic RNA was obtained as described by Russo et al. (1988). A procedure basically similar to that described by Ahlquist & Janda (1984) was used for cloning the 5' end region: first strand synthesis was primed with the oligonucleotide 5' GGTAGACCCTGCCTTCA 3' complementary to nucleotides 104 to 120 of genomic RNA; hybrid R N A - D N A was melted at 100 °C for 1 min, and digested with ribonuclease A. Second strand synthesis was primed by the oligonucleotide 5' ATCGATAATACGACTCACTATAGGAAATCCTCCAGGACA Y, containing 17 bases homologous to the first 17 bases of genomic RNA, 17 bases constituting the T7 promoter consensus (Dunn & Studier, 1983) and five additional bases contributing to formation of a ClaI site. dsDNA was inserted in pUC18 digested with Sinai to produce the clone pCyR-T7. A fragment AccI-KpnI was eluted from a clone (pCyR-
102), previously obtained (Russo et al., 1988), which was ligated to clone pCyR-T7 digested with the same enzymes to obtain clone pCyR-T7/102. This clone was extended by the addition of the fragment KpnI-BamH I from an available clone (pCyR-251), that had been produced by priming first strand synthesis with the oligonucleotide 5' CCTTCTCACAAACTGCT Y, complementary to nucleotides 1351 to 1367 in genomic RNA. Second strand synthesis was carried out in the presence of ribonuclease H and polymerase I according to Gubler & Hoffman (1983). The clone thus obtained is pCyRT7/B. A fragment BamHI-SmaI from clone pCyR-1 (Russo et al., 1988) was ligated to BamHI-SmaI-digested clone pCyR-T7/B to make clone pCyR-T7/S. Finally, the 3' region was obtained by priming first strand synthesis with the oligonucleotide 5' GCATGCCCCTGCATTGCTGCAA 3', which is complementary to 17 bases of CyRSV RNA and has five additional nucleotides, forming a restriction site SphI, which does not occur in the CyRSV sequence (Grieco et al., 1989a). Digestion with SphI cut the D N A immediately after the last G of the genomic RNA. Second strand synthesis was done as before (Gubler & Hoffman, 1983) and cloning was in Sinai-digested pUC18. A fragment Smal-SphI was cut from one such clone (pCyR-SH) and ligated to pCyR-7/S to have full-length clone pCyR-G. The cloning procedure is summarized in Fig. 1 (a). The terminal sequences of pCyR-G (Fig. 1b) were determined by sequencing clones pCyR-T7 and pCyR-SH by the chain termination method (Sanger et al., 1977) using modified T7 polymerase (Sequenase, US Biochemicals). Transcription was made to start with a G residue,
"{"Permanent address: Research Institute for Plant Protection. P.O. Box 102, H-1525 Budapest, Hungary. 0000-9549 © 1990 SGM
1858
Short communication
(a) l
l
2 |
I
3 I
!
Acid KplnI
4 I i
OamHl
kb
I
SmaI
T7 pCyR-T7 I1-"l pCyR-102 T7 p C y R ~ 7 / 1 0 2 ll"-i
T7 •
pCyR-251
pCyR-T7/B pCyR-I
T7 •
pCyR-T7/S pCyR-SH
i T7
I
Sphl
pCyR-G
•
I Sphl
(b) atcgaTAATACGACTCACTATAGGAAATCCTCCAGGACA ..... Clal T7 promoter ( G ) G A A A T C C T C C A G G A C A ..... CyRSV sequence ...... TTGCAGCAATGCAGGGG
catglc
3' end of transcript
ct gtac g
Sph~
Fig. 1. Construction of a full-length copy of CyRSV RNA. (a) Schematic representation of the ligation steps made to prepare full-size DNA clones. Upper line represents genomic RNA with relevant restriction sites. Open bars at 5' and 3' regions are clones prepared in the course of the present work fused lo previous clones (closed bars) of which only the parts of inserts used are shown, (b) Nucleotide sequences of the 5' and 3' termini of full-length clone pCyR-G, showing transcription start site (bent arrow) and end of run-off transcripts. The 5' terminus, G, is shown in parentheses to indicate uncertainty in the assignment of this base,
although the 5' terminus of CyRSV R N A is not known (Grieco et al., 1989a). The run-off transcripts were expected to have authentic 3' termini since they can be produced after linearization with SphI which cuts inserts precisely at the 3' end of genome. Plasmids were purified as described previously (Grieco et al., 1989b) and digested with SphI. Transcription with T7 R N A polymerase was done using a kit from Amersham, essentially as described by the supplier. Capped transcripts were obtained by adding to the reaction the cap analogue mTGpppG (Boehringer Mannheim) at 500 ~tM, and lowering GTP concentration to one-eighth the concentration of the other ribonucleotides. After 1 h incubation at 37 °C, transcripts were extracted wtih phenol and chloroform, precipitated with ethanol and dissolved in water or inoculated directly to test plants. R N A size and concentration were estimated from ethidium bromide-stained gels by visual comparison with positions and band intensities produced by known quantities of viral RNA. RNA synthesized in vitro from clone pCyR-G co-electrophoresed with CyRSV genomic RNA (data not shown). Approximately
2 gg R N A was obtained from 1 pg linearized plasmid. Messenger activity of transcripts was tested in rabbit reticulocyte lysates as previously described (Burgyan et al., 1986), except that the labelled amino acid was [3H]leucine (Amersham; 135 Ci/mmol). Uncapped and capped full-length transcripts yielded a labelled product that electrophoresed with Mr 33000 obtained by translation of viral genomic RNA (Burgyan et al., 1986 (data not shown). Transcripts at a concentration of approximately 200 ~tg/ml were mixed with 1 volume of inoculation buffer (0-05 M-glycine, 0-03 M-KzHPO4, pH 9-2; Heaton et al., 1989) and inoculated into the systemic hosts Nicotiana clevelandii and N. benthamiana (10 ~tl/leaf). Plants inoculated with transcripts developed symptoms 7 to 8 days after inoculation that were identical to those induced by the original isolate, i.e. chlorotic/necrotic lesions in inoculated leaves, followed by systemic distortion and crinkling. Leaf-dip preparations from systemic infections showed the presence of isometric particles that were clearly decorated (Milne & Luisoni, 1977) by an antiserum to CyRSV. The specific infectivity
Short communication
1859
(a) 1
2
3
4
5
(b)
(c) 1
3
4
5
6
1
2
3
4
5
6
-S
--S
Fig. 2. RNA species in plants infected with CyRSV RNA in vitro transcripts. (a) Ethidium bromide-stained agarose gel. (b and c) Northern blots hybridized with probes pCyR-7 of genomic RNA and pCS19 of satellite RNA, respectively. Lanes 1, viral RNA from satellite-free CyRSV; lanes 2 and 3, total RNA from N. clevelandii and N. benthamiana plants, respectively, inoculated with pCyR-G transcript; lanes 4 and 5, RNA from uninoculated N. clevelandii and N. benthamiana plants, respectively; lanes 6, viral RNA from satellite-containing CyRSV. G, sgl, sg2, and S: positions of genomic, subgenomic and satellite RNAs, respectively.
of RNA synthesized/n vitro was estimated by inoculating opposite leaves of Chenopodium quinoa in a random design with transcripts and known concentrations of viral RNA. The average numbers of lesions/~tg RNA/ leaf of capped and uncapped transcripts were 11 and 6, respectively, which was lower than the number induced by control viral RNA (62 lesions). RNA was extracted from plants showing symptoms as described (Russo et al., 1988; Burgyan & Russo, 1988). Samples were denatured with 50~ formamide at 65 °C for 5 min, electrophoresed in 1.2% agarose in 90 mMTris, 90 mM-boric acid, 1 mM-EDTA and stained with ethidium bromide or denatured with formamide and formaldehyde, electrophoresed in 1.2% agarose in MOPS buffer (20 mM-MOPS, 5 mM-sodium acetate, 1 mM-EDTA) containing 2.2 M-formaldehyde (Maniatis et al., 1982) and blotted onto nylon membranes (Amersham). Ethidium bromide-stained agarose gels of R N A extracted from systemically infected leaves showed the presence in inoculated tissues of a strong band at the position of CyRSV genomic RNA (Fig. 2a). Northern blots were hybridized with two nick-translated (Maniatis et al., 1982) cloned probes: pCyR-7, representing the 3'terminal 1000 nucleotides of genomic RNA (Russo et al., 1988), and pCS19, a partial clone of satellite RNA (Rubino et al., 1990). Blots probed with clone pCyR-7 showed genomic and subgenomic RNAs typical of CyRSV infections (Russo et al., 1988) (Fig. 2b, lanes 2 and 3), whereas no satellite RNA could be detected with the specific probe pCS19 (Fig. 2c). It has been shown that when satellite-free isolates of tomato bushy stunt tombusvirus were inoculated into N. benthamiana and into N. clevelandii the virus acquired satellite R N A in the
former case but not in the latter (Gallitelli & Hull, t985), This may not be the case for CyRSV, since both N. benthamiana and N. clevelandii remained satellite-free upon inoculation with in vitro transcripts of CyRSV genomic RNA. Moreover, no satellite RNA was found after four passages of the virus after the first infection with transcripts (data not shown). The results of the present study show the potential of in vitro transcripts of full-length clones of CyRSV. This opens the possibility of studying the generation of defective interfering and satellite RNAs as well as mapping viral functions and understanding the role of specific sequences that control the synthesis of subgenomic RNAs. We thank Dr F. Grieco and Professor G. P. MarteUi, who also revised the manuscript, for helpful discussions during the course of the present work. P. D. Nagy is in receipt of a fellowship from the International Centre for Genetic Engineering and Biotechnology (UNIDO).
References AHLQUIST, P. & JANDA, M. (1984). cDNA cloning and in vitro transcription of the complete brome mosaic virus genome. Molecular and Cellular Biology 4, 2876-2882. BURGYAN, J. & RuSso, M. (1988). Studies on the replication of a satellite RNA associated with cymbidium ringspot virus. Journal of General Virology 69, 3089 3092. BURGYAN, J., RUSSO, M. & GALLITELLI, D. (1986). Translation of cymbidium ringspot virus RNA in cowpea protoplasts and rabbit reticulocyte lysates. Journal of General Virology 67, 1149-1160. DUNN, J. J. & STUDIER,F. W. (1983). Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements. Journal of Molecular Biology 166, 477-485.
1860
Short communication
GALLITELLI,D. & HULL, R. (1985). Characterization of satellite RNAs associated with tomato bushy stunt virus and five other definitive tombusviruses. Journal of General Virology 66, 1533-1543. GRIECO, F., BURGYAN, J. & RUSSO, M. (1989a). The nucleotide sequence of cymbidium ringspot virus RNA. Nucleic Acids Research 17, 6383. GRIECO,F., BURGYAN,J. t~;RUSSO,M. (1989b). Nucleotide sequence of the T-terminal region of cymbidium ringspot virus RNA. Journal of General Virology 70, 2533-2538. GUBLER, U. & HOFFMAN,B. J. (1983). A simple and very efficient method for generating cDNA libraries. Gene 25, 263 269. HEATON, L. A., CARRINGTON,J. C. & MORRIS, T. J. (1989). Turnip crinkle virus infection from RNA synthesized in vitro. Virology 170, 214-218. MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory.
MARTELLI, G. P., RUSSO, M. & GALLITELLI,D. (1989). Tombusvirus group. AAB Descriptions of Plant Viruses, no. 352. MILNE, R. G. & LUISONI, E. (1977). Rapid immune electron microscopy of virus preparations. Methods in Virology 6, 265-281. RUBINO, L., BURGYAN,J., GRIECO, F. & RUSSO,M. (1990). Sequence analysis of cymbidium ringspot virus satellite and defective interfering RNAs. Journal of General Virology 71, 1655-1660. RUSSO, M., BURGYAN, J., CARRINGTON, J. C., HILLMAN, B. I. & MORRIS,T. J. (1988). Complementary DNA cloning and characterization of cymbidium ringspot virus RNA. JournalofGeneral Virology 69, 401-406. SANGER,F., NICKLEN,S. & COULSON,A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, U.S.A. 74, 5463-5467.
(Received 27 February 1990; Accepted 19 April 1990)
